Number 20 Please help I will mark brainliest

Answers

Answer 1

Answer:

H.) The offspring will have the correct number of chromosomes when the sperm and egg are joined

Explanation:

This is because the sperm has 23 number of chromosomes and the egg has 23 number of chromosomes as well. When they fuse, they from 46 chromosomes.

Answer 2

Answer:

I think it is H.

before the egg and sperm join they have half of the chromosomes each when they join the chromosomes add up to the right amount which is 46

Related Questions

What are the 3 main types of star "corpses"? plz hurry

Answers

Answer: white dwarfs, neutron stars, and black holes

Explanation:

submit this form. Not you? Switch account
* Required
3. How do the biotic factors in an ecosystem depend on the abiotic factors

Answers

Answer:

biotic factors depend on abiotic factors for survival

Explanation:

WILL MARK BRAINLIEST!!!!Which of the following processes express the information encoded by DNA
and RNA?
A. Transcription and translation
O B. Asexual and sexual reproduction
C. Photosynthesis and respiration
D. Mitosis and meiosis

Answers

Answer:

Explanation:

Thats the tea

Hope this helps ;)

The process that expresses the information encoded by DNA and RNA is Transcription and translation, so option A is correct. Transcription is the process by which the genetic information stored in DNA is transcribed into RNA.

Transcription is the process by which the genetic information stored in DNA is transcribed into RNA. It involves the synthesis of an RNA molecule using one strand of DNA as a template. The resulting RNA molecule, known as messenger RNA (mRNA), carries the genetic information from the DNA to the site of protein synthesis. Translation, on the other hand, is the process by which the information encoded in mRNA is used to synthesize a specific protein. It takes place in ribosomes, where transfer RNA (tRNA) molecules interpret the genetic code on the mRNA and bring the corresponding amino acids to assemble the protein chain.

Learn more about transcription and translation here.

https://brainly.com/question/29979094

#SPJ2

How is evaporation related to precipitation?

Answers

Since Precipitation is rain evaporation is water which is turning in to gas and goes to the air or atmosphere

when you breathe in air you bring oxygen into your lungs and blow out. A.Carbon dioxide B.oxygen C.carbon monoxide D.hydrogen

Answers

Answer:

Carbon dioxide

Answer:

Carbon Dioxide

Explanation:

How does evolution result in reproductive success?

Answers

Answer:

Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.

Look at the plant in the picture below.
This plant is vascular but does not produce seeds. To which of the following groups does this plant belong?
A. flowering plants
B.
conifers
C.
ferns
D.
mosses

Answers

The answer is C. At first I thought it was D but it actually belongs to clubmosses

The following groups of plant belongs to ferns.

What are the characteristics of ferns?

A fern is a member of a group of vascular plants that reproduce via spores and have neither seeds nor flowers.

In their natural environment, most ferns grow in humid forests or on the bank of a water source, so they generally require very moist soil. Even fern varieties that become drought tolerant as they mature usually require moist soil at planting time.

Similar to flowering plants, ferns have roots, stems and leaves. However, unlike flowering plants, ferns do not have flowers or seeds; instead, they usually reproduce sexually by tiny spores or sometimes can reproduce vegetatively, as exemplified by the walking fern.

Learn more about ferns:

https://brainly.com/question/9505707

#SPJ2

Which of the following characteristics of carbon is responsible for the variety of carbon-based molecules on Earth?

Answers

Answer:

It can form bonds.

Explanation:

(I'm in ap bio so I know a lot, lol, hope that helps)

please help meeeeeeeeeee

Answers

Answer:

Explanation:

D like the person above

HELP ASAP
A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period. Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October. People born in October were more relaxed and could better handle stress. Is the scientist’s research considered science?
Yes, because the scientist conducted his research for an extended period of time.
Yes, because the scientist followed the scientific method.
No, because the scientist conducted his research with 100 people
No, because the scientist followed personalities which is pseudoscience.

Answers

Answer:

No, because the scientist followed personalities which is pseudoscience.

Explanation:

A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period

Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October.

People born in October were more relaxed and could better handle stress

Is the scientist’s research considered science?

No, this are beliefs not necesarily true.

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE

Explanation: hope this helps

i am so confused is this an actual question or is it just random letters?-

What mineral is produced when two atoms of iron Chemically Combined With three Atoms of oxygen

Answers

Answer:

Hematite

Explanation:

Hematite is created with two iron atoms to three oxygen atoms, and magnetite, with three iron atoms to four oxygen atoms, which are both iron oxides.

Why do you think that some definitions of forest have a certain percentage of the land that must be covered in trees?

Answers

Answer:

30 percent tree cover - 2000 - 2009JPEG ... of forest cover vary widely—as much as 6 percent of Earth's land area, or the equivalent area of China.

Explanation:

Please help me due tonight!

Answers

Answer:

Meiosis I ==> Interphase - Prophase - Metaphase - Anaphase - Telaphse - genes

Meiosis II ==> Prophase - Metaphase - Anaphase - Telaphase - genes

unlike mitosis which has only one form

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

Arrange these energy sources from highest to lowest percentage of worldwide use. 1, Nuclear 1. Coal * Hydroelectric

Answers

Explanation:

hydro coal nuclear i think it would like thst

The arrangement of the energy according to the highest to the lowest percentage of worldwide use is coal, hydroelectric and nuclear. The arrangement is 2, 3, and 1.

What is energy?

Energy is a quantitative property that is used in doing any work. The energy is always transferred from one form to another form. It is present in the conserved form.

The energy which is used majorly is coal, then hydroelectricity, which is made by water then the nuclear power plant.

Thus, the arrangement is 2. Coal, 3, hydroelectric, 1. Nuclear energy.

Learn more about energy, here:

https://brainly.com/question/12396199

#SPJ2

the final phase of mitosis characterized by the separated chromosomes reaching the poles
of the cell. The nuclear membrane and nucleolus begins to reappear around each set of
chromosomes

Answers

Answer:

Telophase

Explanation:

How are chromosomes affected by aging

Answers

Answer:

delaying cell senescence, apoptosis, and death

Explanation:

Answer:

the enzyme telomerase adds specific DNA sequence repeats to the chromosome ends that are lost through cell division, thus restoring telomere length and delaying cell senescence, apoptosis, and death

Explanation:

PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.

Answers

Answer:

No, not according to any sciences (unless you mean aliens as in immigrants)

Explanation:

There is no way that we are the only living thing in the entire world. There has to be another species out there. They might be wondering if there is another living thing out in space too.

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

all you need is in the photo

Answers

Answer:

Aerobic means 'with air' and refers to the body producing energy with the use of oxygen. This typically involves any exercise that lasts longer than two minutes in duration. ... Anaerobic means 'without air' and refers to the body producing energy without oxygen.

Explanation:

hope this helps if not i'll try to figure out the answer for you

i need some help on this i dont know can someone plz help me

Answers

Answer:

D is your answer I believe

The folded plasma membrane inside the cell is the ______.
A: endoplasmic reticulum
B: mitochondria
C: vacuole
D: vesicle

Answers

A is the answer because this the only thing that folds

Which other food items were digested by lactase, the enzyme that breaks down milk?

Answers

Answer:

im not sure what you mean by this question but ill answer the best way i can!

Explanation:

Bread and baked goodsMilk chocolate and some candiesSalad dressings and saucesBreakfast cereals and cereal barsInstant potatoes, soups, rice and noodle mixesLunch meats (other than kosher)Cheese flavored crackers and other snacks

these are foods containing lactose in them, which lactase breaks down.

hope this helps!

Does natural selection act on individual or does it act on something else ?

Answers

Answer:

huh

I don't know

Answer:

Yes and no

Explanation:

Natural Selection is the process of organisms adapting to the environment around them so yes individuals are effected through them adapting to the changes and they later pass their good traits to their offspring, and eventually the individuals who don't adapt die off, but the natural selection as a whole is just the process.

The difference between active and passive transport is that–

A. Passive transport requires energy to move molecules up a concentration gradient, and active transport does not.

B. Passive transport can only move specific particles across a membrane, and active transport can move any particle.

C. Active transport requires energy to move molecules up a concentration gradient, and passive transport does not.

D. Active transport moves molecules in animal cells, and passive transport moves molecules in plants.

Answers

Answer:b

Explanation:

Answer:

moves particles from an area of low concentration to an area of high concentration.

Explanation:

edge

which layer of the earth is made out of melted metal?

Answers

The outer core. A molten nickle- iron alloy.

What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.

Answers

What are detrivores?

Detritivores are organisms that feed on the organic waste of dead plants and animals

What are decomposers?

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.

Difference between detrivores and decomposers

Option C is the the correct answer

While detritivores consume both plants and animals, decomposers only consume dead animals.

Answers

Answer:

Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism. However, an allele that is hidden, or not expressed by an organism, can still be passed on to that organism's offspring and expressed in a later generation.

Explanation:

Overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

What is heterozygote?

Heterozygote is defined as a person, animal, or other thing possessing a pair of different alleles of a specific gene, one of which is dominant and the other recessive. One normal allele and one mutated allele, or two distinct mutated alleles, can make up a heterozygous genotype.

The explanation is connected to the fact that each parent has two different gene pools. Furthermore, only 50 percent of each parent's DNA is transferred to their offspring. and that the portion that is passed down is random. Every child has a unique set of genes thanks to the interaction of all these influences.

Thus, overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

To learn more about heterozygote, refer to the link below:

https://brainly.com/question/12891396

#SPJ2

The National Academy of Sciences reported that the Earth's surface temperature has risen by about 1 degree Fahrenheit in the past century. This is an example of a change in Earth's

Answers

Answer:

Global warming is the unusually rapid increase in Earth's average surface temperature over the past century primarily due to the greenhouse gases released by people burning fossil fuels.

Other Questions

Which phrase best completes the diagram?Responsibilities of theJudicial BranchHolding trials forthose accused oftreasonDeciding whetherlaws areconstitutional Only________ can declare war! A $50.00 pair of shoes is disconnected 20%. If sales tax is 8%. What is the amount of tax paid HELP MEEEEE!!What would a comparison of the First and Second Industrial Revolutions show? The first depended on new inventions but the second did not.Both the first and second relied almost entirely on steam power.Both used natural resources and relied almost entirely on telecommunications to send messaged over long distances.Both saw improvements in transportation but a truly national market only emerged in the second. Elise and Kenji are making presentations for a class project. Elise's slideshow starts with a verbal introduction that is 14 seconds long, and then each slide is left up for 4 seconds. Kenji leaves each slide onscreen for 7 seconds, and his introduction lasts 5 seconds. Elise and Kenji notice that their presentations have both the same number of slides and the same duration. How long is each presentation? How many slides are in each presentation? Fill in the blank with the most appropriateanswerEr hat Herbst_______mehram liebstenliebenliebsten The area of a TV screen is 576 squareinches. If the width of the screen is32 in., what is the height? Which country was not a scence of early fighting in world war 2 During 2020, Dyrdeks Skate Shop, Inc., had a cash flow to creditors of $60,000 and the cash flow to stockholders for the year was $70,000. Suppose you also know that the firms net capital spending for 2020 was $1,320,000, and that the firm reduced its net working capital investment by $59,000. What was the firms 2020 operating cash flow, or OCF? There was nothing left for us to do but to take them all, and to educate the Filipinos, and uplift and civilize and Christianize them, and by Gods grace do the very best we could by them.Based on the quote, McKinley is arguingin favor of annexing new territories.against annexing new territories.in favor of helping domestic countries.against helping foreign countries. Which of the following provides the best example artificial selection what's the quotient of 35.862.2 GROCERY STORE PROBLEM: A local grocery store faces demand for one of its items at a constant rate of 20,000 boxes per year. It costs them $5 to process an order and $0.50 per box per year to carry the item in stock. The stock is received three working days after an order is placed. Assume 250 working days in a year and no backordering. What is the demand during lead time assuming that there is no variability When governments inject money into the economy, which of the following are their goals? Check all that apply. Proportion isa. the all-encompassing reproduction of a person or thing.b. the relative size of an object as compared to another, or as compared to the other elementsin the piece.the arrangement of visual elements in a piece, which helps to create understanding andconvey the artist's message.the arrangement of elements in order to create equilibrium and a piece that is aestheticallypleasing.C.d.Please select the best answer from the choices providedABCD [50 Points] The function [tex]y = 4.2\sqrt{0.28 x - 1}[/tex] models the annual number of visitors to an amusement park, where y is the number of visitors in millions and x is the number of years since 1975. Find the first year in which the amusement park had 12 million visitors? How does the hydrosphere affect the atmosphere? German Go to the discussion board and post at least 5 sentences using the present perfect tense (the past tense learned in this unit) about things you did yesterday or last week. Then, ask your classmates about 2 things that they did, ate, played, etc. using the present perfect tense. Please post your response to the Gestern Discussion, and respond thoughtfully to the posts of other students. For information on how this assignment will be graded, please visit the orientation. Change 13/5 to a mixed number PLEASE HELP ME A chemist prepares a solution of barium acetate BaCH3CO22 by weighing out 52.9g of barium acetate into a 100.mL volumetric flask and filling the flask to the mark with water. Calculate the concentration in /gL of the chemist's barium acetate solution. Round your answer to 3 significant digits.