NEED HELP

1. Prokaryote is a simple cycle compared to eukaryotic. The prokaryote is a
simple cycle because of three reasons.

A.
B.
C.

NEED HELP 1. Prokaryote Is A Simple Cycle Compared To Eukaryotic. The Prokaryote Is Asimple Cycle Because

Answers

Answer 1

Answer:

A. Small size.

B. A single cell or unicellular.

C.it has one chromosome which is not true and it is called plastid.

Explanation:

This is because prokaryote are unicellular organisms that lack nucleus and membrane bound organelles. The are smaller in size compare to eukaryotic, which have large surface to volume ratio. They lack mitochondria, Golgi apparatus, endoplasmic recticulum, e t.c. They have only one chromosomes which is not even a true one and it is called plastid. Examples of prokaryote include bacteria.


Related Questions

Which term describes a pure substance that is made up of only one type of atom?
O matter
Orock
O compound
o element

Answers

element. an element is when a substance only contains one type of atom. compound is made of 2 or more

Anything that has mass and takes up space is called __________. *
pressure
viscosity
matter

Answers

Answer:

A

Explanation:

Answer:

matter

Explanation:

jshegdvdjjdbdhrhrvhr

Do all plants respond the same to all abiotic factors?

Answers

Answer:

Light intensity: limited light will limit photosynthesis. This will affect the distribution of plants, and therefore the distribution of animals that eat plants. ... Temperature: temperature is a limiting factor for photosynthesis - and low temperature therefore limits growth of plants.

Why does DNA need to make a transcript of itself and what is this transcript called?

Answers

Answer:

DNA needs to be transcribed itself as a mechanism for the multiplication of its molecules, and this transcription process is called DNA replication.

Explanation:

DNA replication is a mechanism that allows it, from one molecule, to obtain two molecules identical to the original. In other words, it transcribes the information from one of its strands to a new strand.

The process of DNA replication is semi-conservative, because each new molecule is formed by an original strand and a new strand, which contributes to maintaining the integrity of the genetic information.

As a requirement of the cell division process, as mitosis,  DNA must replicate so that each daughter cell has the same genetic information as the original cell. This is why replication of this nucleic acid occurs.

what direction was the texas annexation in?

Answers

They faced washington DC

What is the main function of the smooth and rough Endoplasmic Reticulum in a cell?

Answers

Answer:

Smooth endoplasmic reticulum provides vesicles for the Golgi apparatus whereas rough endoplasmic reticulum provides biochemical for the Golgi apparatus. Both smooth and rough endoplasmic reticulum helps in the synthesis and storage of proteins.

Hope this helped!

Interphase
21. Before Meiosis, comes
cell activities, like making
During interphase, the ce
for example.
22. Uncoiled stringy DNA is called​

Answers

uncoiled stringy dna is called chromatin

Pls help me
10 points

If a defendant appeals the verdict from a state court of last resort, which
court would most likely hear the appeal next?
A. An intermediate appellate court
B. The U.S. Supreme Court
C. A federal district court
D. A municipal court
SUBMIT

Answers

Answer:

b

Explanation: peeps in washington are going crazy.

ANY ALT PEOPLE HERE

Answers

Answer:

LOL THIS IS NOT THE PLACE FOR THIS XDDDDDD

Explanation:

Answer:

thanks for the points

Explanation:

Nitrogen from animal wastes or plant an animal tissue
O must be fixed near leguminous plants,
O is lost from the system.
O is fixed by bacteria and fungi in the soil.
O is already fixed and can be used.

Answers

System is okay better

Nitrogen from animal wastes or plant an animal tissue  is fixed by bacteria and fungi in the soil.

So, option C is correct one.

How plants and animals get nitrogen ?Since our atmosphere contains 78% of nitrogen but it is very difficult  to take directly by plants and animals.Nitrogen is very essential for all living organism.Plants take nitrogen from soil.Some bacteria and fungi are present in the soil who fix nitrogen from the atmosphere and convert it into nitrogen compound.Then this nitrogen from the soil by root system of the plants.Now plant use this nitrogen for synthesis of proteins and other compounds.Animals who feed plants gets this proteins and other nitrogen compound from plants.When plants and animals die , fungi and bacteria present in the soil converts this nitrogenous waste into nitrogenous compound and reuse of nitrogenous compound is repeated again.

learn about nitrogenous waste,

https://brainly.com/question/9423629

#SPJ2

Which is true?
A.Ocean currents affect temperatures on land.
B. The ocean has no effect on the temperature on the land.
C. Ocean water does not move between locations.
D. All ocean water is the same temperature.

Answers

Answer:

I think it's A.

Explanation:

Sorry If I'm wrong

the correct answer is A, hope this helps :))

Do humans and plants get their nutrients the same way?

Answers

Answer:

As humans require a lot of nutritious food for the growth, same way plants also require nutrients in order to grow. Plants which are grown in the soil gets all the required nutrients from the fertilizers and from the land where natural nutrients are stored.

plants use photosynthesis

Someone help me match the last two to their definition
Hypotonic and Isotonic

Answers

isotonic is equal on both sides, and hypotonic is higher inside the cell

Why are the rocks on the bottom folded but the top ones are not? What could’ve caused this?

Answers

Answer: The basic answer could be because of the tectonics plates.

Explanation: Because when two forces act towards each other from opposite sides, rock layers are bent into folds.

Typically, sedimentary rocks are arranged in layers, one on top of the other, the oldest items are listed last, followed by the youngest, this is the concept of "superposition.

Why are rocks folded?

Erosion has removed the top layers of the rocks, resulting in the formation of valleys and hills, the top layer might be penetrated with sufficient power. The plates might shift due to erosion, and plate movement.

Many of the stratified rocks, however, are no longer horizontal, we know that sedimentary rocks that are not horizontal either were created in unique ways.

Therefore, more frequently, were shifted from their horizontal position by subsequent processes, such as tilting during episodes of mountain construction, thanks to the Law of Original Horizontality.

Learn more about rocks, here:

https://brainly.com/question/29561452

#SPJ2

what is the function of mitrochondria

Answers

Answer: Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the chemical energy needed to power the cell's biochemical reactions. Chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).

Explanation:

Answer: The mitochondrionis a double membrane-bound organelle found in most eukaryotic organisms. Some cells in some multicellular organisms lack mitochondria (for example, mature mammalian red blood cells). A number of unicellular organisms, such as microsporidia, parabasalids, and diplomonads, have reduced or transformed their mitochondria into other structures.

Explanation:

MULTIPLE CHOICE QUESTION
Are a majority of the problems associated with down syndrome a result
of an over or under expression of chromosome 21?
under
over

Answers

It would be over because a baby without a birth defect has 46 chromosomes but with a Down syndrome baby they have an extra copy of chromosome which is chromosome 21

Hope this helps

Have a great day/night

In the seventeenth century, Francesco Redi performed experiments using raw meat placed in jars.
• Half of the jars were covered, and half were left open,
• Redi noticed that the meat in the sealed jars did not have maggots, but the meat in the open jars did have maggots.
Redi concluded that only flies could make more flies,
.
Which part of the cell theory corresponds to Redi's findings?

Answers

Answer: B

Explanation:

''New cells come from the existing cells'' is a part of the cell theory which corresponds to Redi's findings.

Experiment performed by Francesco Redi

Francesco Redi conducted an experiment in which he showed that living organisms come from other living organisms. This worked combine with the work of other later scientists, helped to develop the third part of the cell theory which is cells come from other living cells.

Learn more about cell theory here: https://brainly.com/question/3966602

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

1. Energy transfer is inefficient between trophic levels because

A. Molecules are fully digested from each trophic level.

B. Dead organisms and waste are recycled throughout the trophic levels.

C. Organisms within a trophic level are fully consumed.

D. All organisms within a trophic level die.

2. Primary productivity is defined as

A. The rate that plants and other photosynthesis organisms produce organic compounds.

B. The process where green plants and some other organisms convert light energy into chemical energy using carbon dioxide and water.

C. The overall amount of energy captured by plants and other photosynthetic organisms by the chloroplast.

D. The adjusted amount of energy in an ecosystem due to energy use by organisms for respiration.

Thanks if you help, It's highly appreciated. :-)​

Answers

Answer: b dead organisms And waste are recycled throughout the tropic levels.

Explanation:

Answer:

part 2

the rate that plants and other photosynthetic organisms produce organic compounds.

Explanation:

:)

the receptionist said to the manager,'I have booked your flight tickects for Monday'. change into imdirect speech​

Answers

Answer:

The correct answer is-  The receptionist told the manager that he had booked his flight tickets for Monday

Explanation:

Indirect speech is the expression any statement of a consverstaion that occured in past without quoting explicitly. Indirect speech is the stating any quoted statement in simple statement. In this type of speech some grammer and certain noun and pronoun change accordingly.

So the correct indirect speech of the receptionist said to the manager,'I have booked your flight tickects for Monday'. would be The receptionist told the manager that he had booked his flight tickets for Monday


7. What is a layout of chromosomes in humans in order from largest to smallest with the
sex chromoosomes at the end called?

Answers

Answer:

Look down!!! ;)

Explanation:

In a human karyotype, autosomes or “body chromosomes” (all of the non–sex chromosomes) are generally organized in approximate order of size from largest (chromosome 1) to smallest (chromosome 22). However, chromosome 21 is actually shorter than chromosome 22.

Hope this helps!! ;)

What is one way during the G0 phase that a mistake during the cell cycle could result in problens for the G0 phase?​

Answers

The G0 phase (G sub zero) or the zero of G is a period of the cell in which it remains in a vegetative state. The G0 phase is seen as a distinct and quiet stage that occurs outside the cell cycle. This phase is related to the "Post-Mitotic" state because they are in a non-dividing phase outside of the cell cycle; some cell types (such as neurons and heart muscle cells) when they reach maturity (that is, when they are terminally differentiated) become post-mitotic (enter the G0 phase), and perform their main functions for the rest of the life of the organism. Poly-nucleated muscle cells that do not undergo cytokinesis are often considered G0 phase cells.

The G0 phase (G sub zero) or the zero of G is a period of the cell in which it remains in a vegetative state.This phase is related to the "Post-Mitotic" state because they are in a non-dividing phase outside of the cell cycle.

Which muscle cells are often considered as G0 phase cells?

Poly-nucleated muscle cells that do not undergo cytokinesis are often considered G0 phase cells.The G0 phase is seen as a distinct and quiet stage that occurs outside the cell cycle.

Mitosis is the procedure with the aid of which a mobile replicates its chromosomes after which segregates them, producing two identical nuclei in training for mobile division. Mitosis is generally followed by way of same department of the mobile's content material into  daughter cells that have identical genomes.

The two phases of cell cycle are interphase in which DNA replication occurs, 3 stages of interphase are: G1 phase, S phase and G2 phase and mitotic in which division occurs phase. Mitosis occurs after the completion of DNA replication and doubling of chromosome number and cell contents and after mitosis, two daughter cells are produced of equal number of chromosomes.

Therefore, The G0 phase (G sub zero) or the zero of G is a period of the cell in which it remains in a vegetative state.This phase is related to the "Post-Mitotic" state because they are in a non-dividing phase outside of the cell cycle.

Learn more about mitosis on:

https://brainly.com/question/29776367

#SPJ5

7th Grade Science Yes i will brain list
What is a convection current?

Answers

a current in a fluid that results from convection.

Which best describes the relationship between DNA, genes, and chromosomes?
DNA are segments of genes that form tight coils called chromosomes.
Genes are segments of DNA that form tight coils called chromosomes.
Chromosomes are segments of DNA that form tight coils called genes.
Genes are segments of chromosomes that form tight coils called DNA.

Answers

Answer:

genes are segments of chromosomes that form tight coils called dna

The statement that best describes the relationship between DNA, genes, and chromosomes is as follows:

Genes are segments of chromosomes that form tight coils called DNA.

Thus, the correct option is D.

What is Chromosome?

A Chromosome may be defined as a thin thread-like structure that appears during the process of cell division. Such types of thread-like structures are significantly present in the nucleus of the cell.

Chromosomes are made up of DNA, RNA, histones, and some non-histone proteins. Chromosomes were first discovered by E. Strausburger in 1875.

Genes are small stretches that significantly considered the segments of chromosomes. Together they form a tightly coiled structure remarkably known as DNA. Genes carry nucleotide sequences that can produce functional enzymes or proteins.

All such parts carry genetic information with respect to the existence of organisms on the basis of morphology and function.

Therefore, the correct option for this question is D.

To learn more about Chromosomes, refer to the link:

https://brainly.com/question/11912112

#SPJ6

Can u pls help me this is due today I will give brainliest

Answers

Answer:

exmaple z

Explanation:

it is the heaviest so it would require more to push

this is physics not bio btw

work= force x distance

answer: 8kg

explanation: weight is a force, and the distance is equal in all examples...so the heaviest object is going to need the most work to pull through the distance

how do you think the idea of sustainability influences the work of foresters?



help me

Answers

It’s funny because the concept of sustainability is thought to come from field of forestry. Around the year 1700, Carl von Carlowitz described the concept of sustainable forestry.

20 points and will mark brainliest!! Explain how you got it!

Answers

Answer:

OF COUSE IT C

Explanation:

Answer:

C

Explanation:

I think the answer is C.

The different kinds of water effects the water and the sunlight. This helps show how much water and sunlight each plant gets and it will bring results.

I hope this helps you! Have a great day!

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Bacteria reproduce in a process called binary fission which of the following is true about binary fission?

Answers

The answer is D :) the offspring will have identical DNA from their parents

(Many points) PLS HELP QUICK dont guess answer pls ad dont say random answers for points pls

Cheng made a chart to list the functions of certain fish structures.

(The image below)

Which headings correctly complete the chart?

X: Fin
Y: Swim bladder
Z: Lateral line
X: Fin
Y: Lateral line
Z: Swim bladder
X: Lateral line
Y: Swim bladder
Z: Fin
X: Lateral Line
Y: Fin
Z: Swim bladder

Answers

Answer:

x:fin

y:lateral line

z:swim bladder

Answer: The answer for this question is Fin for x  Lateral line for y and

swim bladder for z

Explanation:

I took the test

Other Questions
Why is the sports and entertainment industry so popular? Cite two specific reasons. How will recreation be affected by sea level rise? Read each statement carefully. Choose the word or phrase that best completes each sentence. All Aztec children were expected to . When it came to parenting, women were expected to take care of . A common part of Aztec family life was . Which of these shapes have the same area? Plz help thx Which point is at 44.197 on the number line? Which has a bigger surface area, powder or marble chips Find the slope of the line that passesthrough these two points.(-2, 1); (3, 2) How does the structure of Tim O'Brien's story "Ambush" relate to its title?.The narrator's present life cannot escape the bombardment of his wartime memories and actions.OB.The narrator's war experiences are in the distant past and no longer influence the present.OC. The narrator's platoon was surrounded by the enemy, similar to the way the narrator feels when he is surrounded by hisfamily.OD. The narrator continues to write war stories, but he is unable to talk about his wartime experiences.O E The narrator feels his daughter and the young enemy continually cause him to face his past. help pls A-p-e-x!!!!!!!! What is the purpose of medical ethics? PLZ I NEED HELP AND I DON"T KNOW THE ANSWER!! In a survey of 3,300 people who owned a certain type of car, 1,980 said they would buy that type of car again. What percent of the people surveyed were satisfied with the car? Calculate the speed,distance,or time with the information given Who invented scuba?1. Benjamin Franklin2. Mathew Maury3. Robert Falcon Scot4. Cousteau and Gagnon How many fewer 14 starfish are there than 16 jellyfish and 4 sharks Definition of Nationalism The measures of two sides of a triangle are given {17x-7} and {3x^2+5}. The perimeter of the triangle is 13x^2-14x+12. Find the measures of the third side. Sales TaxSelling Price Rate of Sales Tax Sales Tax$50.004%?The sales tax is $ Identify the ionic compound that can form between potassium as the metal and nitrogen as the nonmetal.help!! Need help for dis question what is it ??