Mr. Chang's class participated in a science experiment where they placed three substances outside in the sunlight to determine which substance would increase in temperature more quickly. How would the motion of the particles of each substance be described if they are allowed to sit in the sun for a duration of 10 minutes?.

Answers

Answer 1

In order to find out which substance would raise in temperature most quickly, Mr. Chang's class conducted a scientific experiment outside in the sunlight using three different substances.

If particles of each substance were permitted to sit in the sun for 10 minutes, how would their motion be described? B. Physical alterations are non-chemical changes that are made to an item or substance. They alter an object's physical characteristics, such as its size, color, texture, volume, or density. To find out more about the science underlying the treat or to find some more at-home experiments, see the resources listed below. Just keep in mind that science is best when it is shared, so tell your friends about your experiment.

To learn more about temperature please click on below link

https://brainly.com/question/11464844

#SPJ4


Related Questions

What electromagnetic wave travels the fastest?

Answers

Answer:

C

Explanation:

Ultraviolet since it is a consumable of light

A rock has a density of 2 g/mL and a mass of 17.5 g. What is the volume of the rock?

HELP PLEASE

Answers

D=m/v then v=m/d=17.5/2=8.75ml

En las olimpiadas del 2012 del colegio villapalos maria gano la carrera de los 100 m en 10,56 s y la de 200 m en 22,34 s ¿en cual fue mas veloz

Answers

Answer:

Fue mas velóz en los 100 m.

[tex]v_{1}=9.47\: m/s[/tex]

Explanation:

Tomando en cuanta que la definición de velocidad es:

[tex]v=\frac{\Delta x}{t}[/tex]

Donde:

Δx es el desplazamientot es el tiempo

La primera velodcidad esta dada por:

[tex]v_{1}=\frac{100}{10.56}[/tex]

[tex]v_{1}=9.47\: m/s[/tex]

La segunda velocidad sera:

[tex]v_{1}=\frac{200}{22.34}[/tex]

[tex]v_{1}=8.95\: m/s[/tex]

Por lo tanto, en el primer tramo fue más rápido.

Espero te haya ayudado!

how fossils influence and change our understanding of the history of Earth and it's species.

Answers

Answer:

Fossils are the preserved remains or traces of animals, plants, and other organisms from the past. Fossils are important evidence for evolution because they show that life on earth was once different from life found on earth today.

Explanation:

The equation below shows a general equation for a reaction, and the amounts of the substance are written underneath.

AB + CD → AC + BD
(15 g) (?) (?) (10 g)

The total mass of the products is 50g. Which best completes the other two amounts?

The amount of CD is 40 g, and the amount of AC is 35 g.
The amount of CD is 35 g, and the amount of AC is 40 g.
The amount of CD and AC would be the same.
The amount of CD and AC is undetermined.

Answers

Explanation:

The amount of CD is 35 g, and the amount of AC is 40 g.

Explanation:

AB + CD \rightarrow AC + BDAB+CD→AC+BD

The law of conservation of mass states that in any chemical reaction, the total mass of the reactants must be equal to the total mass of the products.

In this reaction, we know the mass of one reactant (AB, 15 g) and the mass of one product (BD, 10 g). In order to have the same total mass on the left side and on the right side of the equation, the mass of AC must be 5 g more than the mass of CD. We see that the only choice that satisfies this condition is:

The amount of CD is 35 g, and the amount of AC is 40 g.

In fact, if we assume these masses are correct, we have:

- on the reactant side: m(AB)+m(CD)= 15g + 35g = 50g

- on the product side: m(AC)+m(BD)= 40g + 10g = 50g

so, we have the same mass on both sides of the equation, and the law of conservation of mass is satisfied.

Answer:

B is  the answer on edge

Explanation:

B: The amount of CD is 35 g, and the amount of AC is 40 g.

Which of the following is the best example of motion?
A. Waving your arms
B. Tossing and turning in your bed
C. Walking from home to school
D. Your dog wagging his tail

Answers

Answer:

Maybe A. waving your arms?

I say C: walking home from school.

How much must you raise the
temperature of 1.00 m^3 of water
so that its volume expands by
0.00100 m^3?
Water
B = 207-10-6 0-1
(Unit = C)

Answers

Answer:

4.83 °C

Explanation:

001 = λ*ΔT

ΔT = 10^-3*10^6/207 = 4.83°C

Answer:

4.83

Explanation:

Your little cousin loves ice cream bars. You buy him one and he starts to lick it. As you sit down on a park bench, he drops
the bar on the seat of the bench. You pick up the bar to throw it away, but he starts to cry, so you shrug and give it back to
him. Will he definitely get sick?

Answers

Answer:

nop

Explanation:

It is not certain whether the child will get sick from eating the ice cream bar that was dropped on the bench.

What is contamination?

Contamination refers to the presence or introduction of harmful substances or organisms into a material, environment, or food source.

There is a possibility that the ice cream bar could have picked up bacteria or other contaminants from the bench that could make the child sick. However, the risk of illness depends on a number of factors, including the cleanliness of the bench, the length of time the ice cream was in contact with the bench, and the overall health of the child's immune system.

To reduce the risk of illness, it is important to wash hands and surfaces frequently, especially when handling food. If possible, it is best to discard food that has come into contact with potentially contaminated surfaces to prevent the spread of illness. However, if the child has already eaten the ice cream bar and does become sick, it is important to monitor their symptoms and seek medical attention if necessary.

Learn more about contamination, here:

https://brainly.com/question/30165502

#SPJ7

A globe (model of the Earth) is a hollow sphere with a radius of 16 cm. By wrapping a cord around the equator of a globe and pulling on it, a person exerts a torque on the globe of 120 N • m for 1.2 s. What angular momentum does the globe have after 1.2 s?

Answers

Answer:

144 kg m^2/s

Explanation:

A baseball is thrown with a speed of 36 meters per second (m/s). What is the distance from the mound to home plate if the ball takes 0.5 seconds to leave the pitcher's hand and cross the plate? A-72 B-18 C-41 D-31 Help me out please

Answers

Answer:

d = 18 m

Explanation:

Given that,

The speed of a baseball, v = 36 m/s

We need to find the distance from the mound to home plate if the ball takes 0.5 seconds to leave the pitcher's hand and cross the plate.

Let the distance be d. We can find it using the formula,

Speed = distance/time

or

[tex]d=vt\\\\d=36\times 0.5\\\\d=18\ m[/tex]

So, the required distance is equal to 18 m.

When you are sitting in a chair, your body exerts a _____
on the chair and the chair exerts the ____ force back.

it can either be:
force
friction
same
different
interacting objects
mass
or push

Answers

When you are sitting in a chair your body exerts a FORCE, the chair exerts the SAME force back.

neeeeeeddddddssssshelp

Answers

Answer:

valence

Explanation:

Robb wants to win the next sled race. He asks for your advice. What would you tell him he should change in order to win? Explain why your solution would work in terms of energy.

Answers

Answer: Start at the top of the hill.

Explanation:

The options include:

a. Start at the bottom of the hill.

b. Start at the top of the hill.

c. Start in the middle of the hill.

Sled racing is simply a winter dog sport racing. Since Robb wants to win the next sled race, the advice that'll be given to him is that he should start at the top of the hill.

Other options such as starting at the bottom of the hill or the middle of the hill are wrong.

1. Rearrange the equation for the area of a rectangle (A = l w) to solve for length, l.
Step 1


Step 2


Step 3


Step 4




2. Rearrange the equation for velocity v = d/t to solve for time, t.
Step 1


Step 2


Step 3


Step 4

Answers

http://www.panthercountry.org/userfiles/241/Classes/611/Rearranging%20Algebraic%20Equations.pdf


there’s a link

Decribe the general shape of the graph.​

Answers

Answer:

the results increase, positive

A car and a semi-truck are both traveling along a road. Based on Newton's 2nd law, what will happen if both cars apply the same type of brakes at the same time?

Answers

Answer: ask god in your prayers

Explanation: im here for the same reason you are

I DONT KNOW THE ANSWER

Answer:

The semi-truck will stop after the car.

Explanation:

It will do that because the semi-truck has more mass than the car.

A car travels 9 km East, turns around, then travels 3 km West. What is the car's
DISPLACEMENT? *

Answers

Explanation:

I think you are 100℅ clear.

How is the reflection of a light
ray from a plane mirror different from the
refraction of a light ray as it
enters a piece of glass?​

Answers

Explanation:

Because during reflection of light rays from plane mirror only bouncing back of light rays takes place while as during refraction of light rays through a block of glass bending of light rays occurs.

Calculate the force of an object shot in the air with a mass of 2 kg and an acceleration of 9.81 m/s2.

Answers

Answer:

Force = 19.62 Newton

Explanation:

Given the following data;

Mass = 2kg

Acceleration = 9.81 m/s²

To find the force;

Newton's Second Law of Motion states that the acceleration of a physical object is directly proportional to the net force acting on the physical object and inversely proportional to its mass.

Mathematically, it is given by the formula;

Force = mass * acceleration

Substituting into the formula, we have;

Force = 2 * 9.81

Force = 19.62 Newton

why don't planets crash into each other?​

Answers

Answer:Planets can't be in just any orbit, they have to be far enough apart so that they don't hit each other, and aren't drawn into collision by gravity

Explanation:

Atmosphere is key to gravity as they orbit .

An object is located 20.0 cm from a convex lens. The lens focuses light at a
distance of 10.0 cm. What is the image distance?

A. 6.67 cm
B. -6.67 cm
C. -20.0 cm
D. 20.0 cm

Answers

The Answer Is :  D. 20.0 cm

My Reason : These types of problems can all be solved using the lens or mirror equation.

1/20 +1/q= 1/10

q=20 cm

The image is formed behind the lens at 2f or the center of curvature.

It is real, inverted, and the same size as the object

The Answer Is: D. 20.0 cm

Explanation: I did the test :)

What can we say about the forces? A. They are balanced. B. They are unbalanced. C. They are not in equilibrium.​

Answers

You can say anything you want to about them without fear of contradiction. There's no information here to prove you wrong.

A 100 L ball is blown up inside at 200K. It is then taken outside in the hot sun, and the volume increases to 150 L. What is the new temperature?​

Answers

Answer:

Temperature, T2 = 300 Kelvin

Explanation:

Given the following data;

Initial volume = 100 Liters

Initial temperature = 200 Kelvin

Final volume = 150 Liters

To find the final temperature T2, we would use Charles' law.

Charles states that when the pressure of an ideal gas is kept constant, the volume of the gas is directly proportional to the absolute temperature of the gas.

Mathematically, Charles is given by;

[tex] \frac {V}{T} = K[/tex]

[tex] \frac{V1}{T1} = \frac{V2}{T2}[/tex]

Making T2 as the subject formula, we have;

[tex] T_{2}= \frac{V_{2}}{V_{1}} * T_{1}[/tex]

Substituting into the formula, we have;

[tex] T_{2}= \frac{150}{100} * 200[/tex]

[tex] T_{2}= 1.5 * 200 [/tex]

Temperature, T2 = 300 Kelvin

The equivalent resistance in a series circuit is found by ____
the resistances of all the resistors.

A. multiplying
B. comparing
C. adding the reciprocals of
D. adding​

Answers

Explanation:

In a series circuit the equivalent resistance is the algebraic sum of the resistances.

Plan an experiment to measure the ideal mechanical advantage of a three-hole punch. (a) What materials would you need? (b) What procedure would you use?

Answers

Answer:

A) Three hole punch and either a layered plastic or paper

B) Identify the lengths involved  ,

  Length of input arm / length of output arm = L1/ L2

Explanation:

a) Materials involved includes :

Three hole punch and either a layered plastic or paper

Identify the forces acting on the three-hole punch which are Input and output forces

Identify the points where they act

B) procedures involved

The mechanical advantage = output force / input force

step one:  Identify the lengths involved

assuming no friction or relatively small friction \

mechanical advantage can be calculated as : Length of input arm / length of output arm = L1/ L2

which lens have plus power ​

Answers

Answer:

Explanation:

A plus lens which is convex in shape, converges light and the accommodative system must relax in order to keep an image clear.

A wave traveling at 200 m/sec has a wavelength of 2.5 meters. What is the frequency of this wave

Answers

Answer:

600Hz

Explanation:

The constant movement of rising warm air and sinking cool air in Earth's atmosphere is called atmospheric convection. What does atmospheric convection produce?

Answers

Answer:

sunspots

Explanation:

Which applications, either for diagnostic purposes or for therapeutic purposes, do not involve ionizing radiation? Check all that apply.

Answers

Answer: I do not know (is this an RP question? ;-;)

Explanation:

Answer:

Applications in which ionizing radiation are not used are  

MRI

ultrasound

laser surgery

Explanation:

hope its right

bestfriend

If a body carries a charge of +3 C, then which of the following is true?
а) It has an excess of 4.8 x 10^19 electrons
b) It has an excess of 1.87 x 10^19 electrons *1019
C) It is deficit of 1.87 x 10^19 electrons
d) It is deficit of 4.8 x 10^19 electrons​

Answers

Answer: C) it is deficit of 1.87 x 10^19 electrons

Explanation:

Other Questions
A line with a slope of 4 and passes through (2, 4) What is the equation of the line in slope intercept form (y = mx + b) ? What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number?