Michelle is typing an e-mail to team members. The e-mail includes some issues that were discussed during a meeting and decisions that were made. Michelle is writing the _____.

Answers

Answer 1

Answer:

issues that were discussed in the meeting

Explanation:


Related Questions

This is Pete's PPC curve for staying in touch with friends via phone vs. his weblog during one week. Pete plans to write four entries to his weblog. How many conversations with friends can he have to efficiently use his time? 0 1 4 6

Answers

In order to efficiently use his time, the conversations with friends Pete can have is 4.

The production possibilities curve depicts the ways two goods can be combined in order to fully utilise resources. The PPC is concave to the origin.

Points on the curve indicate an efficient level of production.  Point outside the PPC means that the production level is not attainable given the level of resources . Points inside the PPC indicates that resources are not been fully utilized.  

If Pete wants to write 4 blog entries, trace the 4 on the y-axis to the curve and trace it to the x-axis. Based on this, Pete can have 4 conversations with friends.

Please find attached an image showing the required graph. To learn more about the PPC, please check: https://brainly.com/question/8074245

Brand equity is…………………?

Answers

Answer:

Brand equity, in marketing, is the worth of a brand in and of itself — i.e., the social value of a well-known brand name.

100 points!
Will report if fake answer
A more wordy and complex way to say "we are cringe"

Answers

Answer:

We are excruciatingly awkward and humiliated

Answer:

we are extremely embarrassing

we make you feel tremendously uncomfortable

Explanation:

Which of the following statements is the best way to state your position in a conflict?
a.
“I am concerned you aren’t telling people the truth about me.”
b.
“I feel betrayed by what was said about me.”
c.
“You aren’t telling me what you tell other people.”
d.
“You need to let me know what you think about me to my face.”

Answers

Answer:

A

Explanation:

A plainly states your position in an argument.

How much money should be deposited annually in a bank account for five years if you wish to withdraw ​$3 comma 000 each year for three​ years, beginning five years after the last​ deposit? The interest rate is 4​% per year.

Answers

The amount to be deposited in the bank for five years is $1729.

The first step is to determine the present value of $3000.

Cash flow in year 1 - 4 = 0

Cash flow in year 5 - 7 = $300

I = 4%

PV calculated using a financial calculator = $7,116.48

The second step is to determine the future value of the present value calculated above

$7,116.48 x (1.04)^7 = $9,364.80

The third step is to determine the amount to be deposited each year for 5 years:

Amount = future value /annuity factor

Annuity factor = {[(1+r)^n] - 1} / r

= [(1.04)^5 - 1] / 0.04 = 5.416323

Amount = $9,364.80/ 5.416323 = $1729

A similar question was solved here: https://brainly.com/question/24108530

Discounting a stream of benefits is defined as
a. a single-period valuation model that converts a benefits stream into value by dividing the benefits stream by a rate of return that is adjusted for growth.
b. a single-period valuation model that converts a benefits stream into value by dividing the benefits stream by a rate of return that does not consider growth.
c. a multi-period valuation model that converts revenue into value by discounting the revenue stream by a rate of return.
d. a multi-period valuation model that converts a future series of benefit streams into value by discounting them to present value.

Answers

Answer: D

Explanation:

Please help for this question

Answers

Answer:

task based maybe ?

Explanation:

if it's correct than mark me brainliest

Visit ikea.my and identify the services the company provides to its customers.

Answers

okay i will thank you take care

Which is not a consideration when allocating assets and diversifying? A. Real estate holdings B. Avoiding similar investments C. Rate of return D. Portfolio size​

Answers

When one is considering the allocation of their assets as well as how to diversify them, they don't consider A. Real estate holdings.

Diversification involves:

Investing in non-similar assets. Investing in a wide array of different assets to reduce risk.

When thinking about diversifying your assets, one doe not have to think about the number of real estate holdings they already hold as there are other assets to invest in.

In conclusion, option A is correct.

Find out more about diversification at https://brainly.com/question/14081320.

Answer:D

Explanation:

Just took the test

Circuit Pro, a manufacturer of electrical circuits, wants to decrease the per-unit cost of making its products. Which incentive should Circuit Pro offer to align workers with firm-level strategic objectives

Answers

Based on the information given, the incentive that should be used is that an employee with a cost-cutting idea will be paid 10% of the first-year savings.

Strategic objectives simply mean the purpose statement that are vital in creating an overall vision for a company and setting its goals to achieve desired outcome.

Since the manufacturer of electrical circuits, wants to decrease the per-unit cost of making its products, the incentive should be that an employee with a cost-cutting idea will be paid 10% of the first-year savings. This will help the workers align with the objective

Learn more about incentive on:

https://brainly.com/question/8992482

Help help help buissness help help

Answers

Answer:

B

Explanation:

Answer: B

Explanation:

If only one airline serves a town, does a monopoly exist? What about competition from other services?

Answers

If only one airline serves a town, the question of whether a monopoly exists is:

Yes, a monopoly exists

Based on the given question, we are asked to state whether a monopoly exist in a situation where there is only one airline in a town, and the answer is, yes, that is a monopoly

It is important to note that a monopoly has to do with the domination of one company in a market system whereby there is little to no competition from other companies. In this situation, there is usually higher prices of products because there is a lack of competition for competitive prices.

Read more about monopoly here:

https://brainly.com/question/13113415

If you wish to enter the field of soil and
forest conservation, what kind of
educational goal should you attain?

A. High school diploma
B. 2 year associate degree
C. 4 year college degree
D. Doctorate degree

Answers

4 year college degree is the minimum educational goal to attain if one wish to enter the field of soil and forest conservation.

The 4 year college degree is tantamount to the Bachelor degree achieved from University, college etc.

Usually, the position of forestry and related job requires the minimum of Bachelor degree from related course in the field of soil and forest conservation.

Hence, the 4 year college degree is the minimum educational goal to attain if one wish to enter the field of soil and forest conservation.

Therefore, the Option C is correct.

Read more about forestry

brainly.com/question/24518939

A professional mentor should be used for guidance on which of the following?

the development of a mentee’s resume
improving of a mentee’s presentation skills
the hair color of the mentee for a date
which car would be best to rent for a weekend ski tri

Answers

Answer:

Answer:

1. The development of a mentee's resume

2. Improving of a mentee's presentation skills

Explanation:

A professional mentor can be involved in the services like developing a mentee's resume; and improving his presentation skills.

What are the roles of a professional mentor?

A professional mentor is someone who offers his services to a mentee by training in the skills that would help him in achieving his organizational and career goals.

In the above example, a professional mentor has to work on development of his mentee's resume to help him attract more employers at an attractive pay.

Hence, options A and B as aforementioned are the areas of work in which in the guidance of a professional mentor is required.

Learn more about professional mentor here:

https://brainly.com/question/14016081

#SPJ2

what is organization?

Answers

an organized group of people with a particular purpose, such as a business or government department.

Answer:

    An Organization or Organisation is entity such as a company, An institution  or an association, Comprising one or more people and having a particular purpose. The word is derived from the a Greek word Organon, Which means tool or instrument, Musical instrument and organ....

                  ...............................

please help!!

Bobby is an electrician who specializes in installing electronic locks. What kind of company might be interested in hiring Bobby?

A.
a national hotel chain

B.
a meat packing facility

C.
a local parks department

D.
a printing company

Answers

Answer:

a . national hotel chain

Explanation:

because electrician who install lock are supposed to work at a hotel for the safety of the people

Answer:

I think it's A ? I'm not 100% sure, but hotels often have electronic locks that you need a key card to open

Help help buissness help help

Answers

Answer:

My best guess will have to be A

Explanation:

most research I did was talking about money stability

Answer:a control of money

As a multinational corporation, Starbucks is able to


A establish coffee prices for all companies

B lower product standards

C sell coffee only in the United States

D sell coffee to other parts of the world

Answers

As a multinational corporation, Starbucks can D. sell coffee to other parts of the world.

Characteristics of a multinational corporation: It is registered and has business operations in more than one country.For example, Starbucks has its headquarters in the U.S.It can operate wholly or partially owned subsidiaries in other countries.Sell its franchise to other companies using its brand name.

Starbucks may not establish coffee prices for all companies or lower product standards, or sell coffee only in the United States.

Thus, Starbucks can sell coffee to other parts of the world.

Learn more about multinational corporations here: https://brainly.com/question/13312055

Answer: d

Explanation:

The difference between the lower class limits of adjacent classes provides?

Answers

Answer:

C

Explanation:

The number of textile and agricultural jobs in NC have decreased due to:

Answers

The downfall of the textile industry in South Carolina was attributed to factors such as cheaper labor elsewhere, technology, automation, and other factors related to modernity, wages, education, and economic diversification.

What do you mean by economic diversification?

Economic diversification is the process of transitioning a country's economy from a reliance on a single revenue stream to a variety of sources coming from an expanding number of industries and markets.

It has historically been used as a tactic to promote beneficial economic growth and development.

Diversifying away from vulnerable goods, markets, and jobs in favor of revenue sources that are low-emission and more climate resilient becomes more pertinent in the context of adaptation to climate change.

With more than 2,800 unique products exported to more than 120 nations, Chile is an example of a varied economy. Zambia, a country with equal copper resources, exports just over 700 goods, or one-fourth of Chile's total exports, and only to 80 nations.

Learn more about economic diversification, here

https://brainly.com/question/30034732

#SPJ1

Sunland Company has 1050 shares of 4%, $100 par value, cumulative preferred stock and 52500 shares of $1 par value common stock outstanding at December 31, 2020. What is the annual dividend on the preferred stock

Answers

Based on the information given the annual dividend on the preferred stock is : $4,200.

Using this formula

Annual dividend=Number of shares× Par value× Shares Percentage

Where:

Number of shares=1050 shares

Par value=$100 par value

Shares Percentage=4% or 0.04

Let plug in the formula

Annual dividend=1050shares× $100×0.04

Annual dividend=$4,200

Inconclusion the annual dividend on the preferred stock is : $4,200.

Learn more about annual dividend here:https://brainly.com/question/25557702

Kevin has a client who wants to invest in an account that earns 3% interest, compounded annually. The client opens the account with an initial deposit of $5,000, and deposits an additional $5,000 into the account each year thereafter. Assuming no withdrawals or other deposits are made and that the interest rate is fixed, the balance of the account (rounded to the nearest dollar) after the tenth deposit is __________.

Answers

Considering the situation described above, the balance of the account (rounded to the nearest dollar) after the tenth deposit is "$56,650."

What is Sinking Fund?

Sinking Fund is the term used to describe the fund created by individuals by specifically setting revenue in a particular place like savings over a given period to fund a future capital expense or repayment of long-term debt.

Given that this is more like a Sinking Fund hence, we calculate using the below formula:

S = N [ (1+r)^n - 1 ] /r

where r = 0.030

n = 10 years

N = 5,000

S = 5,000 [ (1.030)^10 -1 ]/.030

= 5,000 [ 1.34 -1 ]/.030

= 5,000 [ 11.33]

= $56,650.

Therefore, we got $6,650 in concern.

Hence, in this case, it is concluded that the correct answer is "$56,650."

Learn more about Sinking Fund here: https://brainly.com/question/10709829

Answer: $57,319

     

Explanation: I'm positive the answer is $57,319 because I had this same exact test question and my answer was correct.

3. Aesop is not using traditional advertisements or discount sales to promote its products. Instead, Aesop gets its promotional communication mostly by word-of-mouth for the design of its products, stores, and events, which are a singular mix of indulgent product experiences, thoughtful language, and modern minimalist design. If you had to interact with Natura & Co SA, which customer engagement model--Natura's, The Body Shop's, or Aesop's-- would be the best for you and why?

Answers

Based on the information given, the model that will be appropriate for the company is the client commitment model.

The client commitment model is a model whereby a company provides and meet the needs of the customers. It is important as it assists the brand with comprehension.

Therefore, the interaction with interact with Natura & Co SA, will ensure that they use this model in order to get more customers, improve sales, and get more profit.

Learn more about models on:

https://brainly.com/question/24414910

What is Revenue?
What is Expense?

Answers

Answer: Revenue is the total amount of income generated by the sale of goods or services related to the company's primary operations and Expenses are the costs required for something; the money spent on something.

Baby Goods Inc. buys Child Shops Inc. in an attempt to gain monopoly power. Remedies that a court might impose in a suit against Baby Goods for a violation of the antitrust laws include Group of answer choices using its market power to encourage increased competition. funding new entries to the relevant market. divesting itself of the control or ownership of Child Shops. all of the choices.

Answers

Based on the information given regarding the monopoly power, the remedy by the court will be divesting itself of the control or ownership of Child Shops.

It should be noted that antitrust laws are put in place in order to protect consumers from business practices that are predatory and also ensure fair competition.

Since antitrust laws recommend the breaking of certain business conducts, there'll be the divesting of the company of the control or ownership of Child Shops.

Learn more about monopoly on:

https://brainly.com/question/13113415

Which of the following is classified as
M22
A large certificates of deposit
B gold and silver
C money market accounts

Answers

I think is C

Hope this helps sry if I’m wrong

Help help help help pelsss please please business

Answers

B because to much of a increase could hurt the economy

compensation Policy issues , include a company's policies concerning all the following except Select one
a Setting the salary and promotion strategy
b . The minimum salary they are legally obliged to pay
c The of paid and unpaid leaves as well as holidays
d Defining the probationary pay versus the final employment pay
e Deciding on the Payment for overtime hours.​

Answers

It should be noted that compensation policy issues refer to all the company's policies given except E. Deciding on the Payment for overtime hours.​

A compensation policy simply means the principle of action that is proposed by a company or organization in regard to the salary, benefits, and bonuses of the employee.

It includes setting the salary and promotion strategy, the minimum salary they are legally obliged to pay, etc. It doesn't have to do with deciding on the payment for overtime hours.​

Learn more about compensation on:

https://brainly.com/question/25301308

What are three differences between a public sector and public corporations?

Answers

Explanation:

Comparison Table Between Public Sector and Public Limited Company (in Tabular Form) Public sector companies are controlled by the state or central government. ... A public sector company is not listed in the share market. A public limited company is listed in the share market and also requires going for an IPO.



• • 13.16 A large St. Louis feed mill, Robert Orwig Processing,

prepares its 6-month aggregate plan by forecasting demand for

50-pound bags of cattle feed as follows: January, 1,000 bags;

February, 1,200; March, 1,250; April, 1,450; May, 1,400; and June,

1,400. The feed mill plans to begin the new year with no inventory

left over from the previous year, and backorders are not permit-

ted. It projects that capacity (during regular hours) for producing

bags of feed will remain constant at 800 until the end of April, and

then increase to 1,100 bags per month when a planned expansion

is completed on May 1. Overtime capacity is set at 300 bags per

month until the expansion, at which time it will increase to 400

bags per month. A friendly competitor in Sioux City, Iowa, is also

available as a backup source to meet demand—but can provide

only 500 bags total during the 6-month period. Develop a 6-month

Answers

The production plan is used for ensuring that the necessary preparation is completed before the start of a production cycle.

A production plan involves the allocation of resources effectively so that everything will be in place for the production stages.

Based on the computation done, the budget for January is $12800, February is $16250, March is $17175, April is $20875, May is $16900, and June is $16900.

Learn more about production on:

https://brainly.com/question/4139284

Other Questions
What trick of trust describes why companies trying to sell you something will often use terms like 'limited edition' or 'limited time deal', or even put countdowns of time left or number of items left on the screen de un grupo de 22 estudiantes hay 13 que practican natacin y 10 practican atletismo y 2 que no practican nada . Cuntos practican solo atletismo? AYUDA 16. All of the following are elements of culture EXCEPT______a. Economic Systemsb. Governmentc. Languaged. Food What do the following two equations represent?. 4x + 2y = 10 4x 2y = 10Choose 1 answer:The same lineDistinct parallel linesPerpendicular linesIntersecting, but not perpendicular lines If you are the driver or owner of a vehicle which is in a crash that is your fault and you are not. Malik jogged 2 miles in 20 minutes.What was his rate in miles per hour?10 miles per hour6 miles per hour23 mile per hour110 mile per hour the smallest division value of electronic balance Astatine-218 has a half-life of 1.6 seconds. If you begin with a 1.7 g sample of astatine-218, how much of the sample remains after 3.2 seconds? explain different users of computer in briefly? Find the area of the cuboid. The valence electrons of a krypton (Kr) atom in the ground state are located in theA. first energy level (shell).B. second energy level (shell).C. third energy level (shell).D. fourth energy level (shell). Which model below shows the positions of the Sun, Moon, and Earth that have the greatest effect on ocean tides? Pleaseeee help meee with this!!!!!!!!!!!! Norton Company purchased a building on January 2 by signing a long-term $480,000 mortgage with monthly payments of $4,500. The mortgage carries an interest rate of 10 percent. The amount owed on the mortgage after the first payment will be A town has two shopping malls. A survey conducted on the shopping preferences of the town's residents showed that 62% of the residents visit Comet Mall, 73% of the residents visit Star Mall, and 48% of the residents visit both malls. The probability that a resident is chosen at random shops at either Comet Mall or at Star Mall is Help me pleaseeeeeeeeeee AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA {(23,4),(-3,8),(-25,-21),(20,13),(21,-14)} what is the domain and range Accelerated mammary gland development in intellectually disabled. What is the product of 44(4-7)(4)?-16O-1 -12-1008DONE