Manhattan Developers, Inc., pays Northeast Trust Company to release its claim to a strip of waterfront property. Northeast gives Manhattan a deed that conveys only whatever interest Northeast has in the strip. This deed is

Answers

Answer 1

"Manhattan Developers, Inc., pays Northeast Trust Company to release its claim to a strip..." this is a quitclaim deed. This is further explained below.

What is a deed?

Generally, the deed is simply defined as Legal documents that are signed and delivered, particularly those that deal with property or legal rights.

In conclusion, When a company pays another company to relinquish a claim to a strip mine, it is executing a quitclaim deed.

Read more about deed

https://brainly.com/question/17214313

#SPJ1


Related Questions

A Blank______ grants an inventor exclusive rights for a defined period to the manufacture, use, or sale of his or her invention. Multiple choice question. patent copyright trademark watermark

Answers

Answer:

Patent

Explanation:

A patent allows one to trademark or copyright and invention in a sense, which in turn allows the inventor exclusive rights to their invention

Brainliest please? I just need one more for the next rank

Question 3 of 20
Which statement describes why you should start retirement planning early?
A. Your income will increase, while your expenses will decrease.
O B. Your income will decrease, while your expenses will increase.
O C. Your income will decrease, while your expenses will stay the
same.
O D. Your income will increase, while your expenses will stay the same.
SUBMIT.

Answers

Answer:

B) Your income will decrease, while your expenses will increase

Explanation:

You should start retirement planning early, because as you grow up you may become less skilled or not be able to perform heavy work. As you get older expenses will increase for various reasons, inflation, which will make goods more expensive, forcing you to spend more and also medical bills,  treatments, therapies, check-ups or preventive studies, can make you spend more in an older age.

Karat packaging has entered a stage in which the demand for their innovative fax machines has declined. now most customers are buying replacement parts or buying their second fax machine from the firm. what stage in the industry life cycle does this scenario describe

Answers

Karat fax machines have reached maturity. Because sales have dropped and people are only ordering replacement parts or a second fax machine, this is the reason. The product is either rejected or only repaired at the maturity phase. There aren't many new sales.

What is maturity stage in product life cycle?

Maturity level in the product life cycle is the stage where the sales of product of the company starts declined because of the new trends and innovation in the market.

At this stage of maturity, The company must go for the heavy discounts and low in the price levels to stay competitive in the marketplace and at least take out their invested amount from sales.

Thus, Karat fax machines have reached maturity.

For more details about maturity stage in product life cycle, click here:

https://brainly.com/question/4235955

#SPJ1

Economics is the study of how individuals and societies allocate.

Answers

The field of Economics allows us to study how individuals and societies are able to allocate resources.

What is economics?

Economics is a field that studies the allocation of resources by a society to ensure that the needs of the society are met.

The reason the allocation of resources needs to be studied is because they are scarce and so have to be allocated with opportunity cost in mind.

Find out more on opportunity cost at https://brainly.com/question/1549591.

#SPJ1

find the average rate of change for the following and write a description about it

Answers

In order to find the rate of change of a function between two points, you should use the formula, ( f (b) - f (a) ) / (b - a).

How do you find the rate of change?

Using the formula;

= ( f (b) - f (a) ) / (b - a)

Where

b would be the second value of x and a would be the first value of x.

For instance, if you were to find the average rate of change in function:

y = 4x³ - 5x² + 1 in between x = -3 and x = 1.

The average rate of change would be:

= ( 4 (1)³ - 5(1)² + 1) - (4 (-3)³ - 5(-3)² + 1) / (1 - (3))

= 152 / 4

= 38

Find out more on the average rate of change of functions at https://brainly.com/question/7448057.

#SPJ1

A __________ offers a huge selection of one type of product (such as books, toys, or sporting goods) to dominate that category of goods.

Answers

shopping outlet or a shopping complex

When delegating a task, it is important to _______. a. give away the most difficult things on your task list b. go over everything quickly and return to your own work c. keep the responsibility for getting the tasks done d. report everything that is expected of the person please select the best answer from the choices provided a b c d

Answers

Delegating a task works better when we d. report everything that is expected of the person.

What makes delegation work?

Delegation is very effective because it divides tasks and reduces the time taken for those tasks to be done because multiple people would be doing it.

For it to work, however, the people who have been delegated to, need to understand exactly what it is they are meant to do.

Find out more on delegating duties at https://brainly.com/question/4617536.

#SPJ1

Which loan type allows you borrow up to the cost of attendance, minus other aid you have received?.

Answers

A subsidized loan is such a loan where the borrower is allowed to borrow up to the cost of attendance less any other aids received.

What is a subsidized loan?

A type of education or student loan where the amount to be borrowed is determined as per the cost of the student's attendance, which is subtracted from other financial benefits received in this regard, is known as a subsidized loan.

Hence, subsidized loan is explained as above.

Learn more about subsidized loans here:

https://brainly.com/question/2256061

#SPJ1

Allison's supervisor shared some information about the new procedure in the Employee Handbook in a meeting with all of the people in the supervisor's division. This is an example of _______________________. downward communication None of the above upward communication horizontal communication

Answers

An example of  horizontal communication is when the supervisor shared some information about the new procedure in the Employee Handbook in a meeting with all of the people.

What is the Horizontal communication?

This refers to a transmission of information between staffs of a departments within the same level of operation.

Hence, the Horizontal communication is used by the Allison's supervisor.

Therefore, the Option D is correct.

Read more about Horizontal communication

brainly.com/question/12349431

#SPJ1

Sam is carrying a balance on his credit card of $500. The credit limit on the card is $1,500. What is his utilization rate?

Answers

The utilization rate of Sam that carrying a balance on his credit card of $500, that having a limit of $1,500, is 33%.

What is credit card?

Credit card is a plastic card that is used for withdrawing the excess amount from the bank account. This card is generally issued by the banks to their customers.

Sam's credit card use rate is 33 percent because he has a $500 load on his card with a $1,500 limit.

Therefore, the utilization rate is 33%.

Learn more about the credit card, refer to:

https://brainly.com/question/27350251

#SPJ4

One of your customers has decided to commit $10,000 to fixed income. She is trying to decide if it makes more sense to invest in the bonds of a single corporate issuer or to buy an exchange-traded fund (ETF) tracking a corporate bond index. You could explain that the purchase of the ETF results in the greatest reduction of

Answers

"One of your customers has decided to commit $10,000 to fixed income..."You could explain that the purchase of the ETF results in the greatest reduction of liquidity risk. This is further explained below.

What is liquidity risk?

Generally, liquidity risk is simply defined as, to put it another way, liquidity risk is the possibility of experiencing losses as a consequence of not being able to make payments on time or doing so at an unaffordable price.

In conclusion, Fixed-income investments have been made by one of your clients for $10,000..." In other words, you might say buying the ETF lowers liquidity risk the most.

Read more about liquidity risk

https://brainly.com/question/921670

#SPJ1

How might international trade impact the labor demand curve and wages. Group of answer choices Workers in industries impacted by imported products will see the demand curve shift left and wages decrease. Workers in industries that export products will see the demand curve shift right and wages increase. Workers in industries that export products will see the demand curve shift left and wages decrease. Workers in industries impacted by imported products will see the demand curve shift right and wages decrease.

Answers

International trade impact the labor demand curve and wages as D. Workers in industries impacted by imported products will see the demand curve shift right and wages decrease.

What is an international trade?

It should be noted that international trade simply means a trade that takes place with another country outside ones border.

In this case, international trade impact the labor demand curve and wages as the workers in industries impacted by imported products will see the demand curve shift right and wages decrease.

Learn more about international trade on:

brainly.com/question/15115779

#SPJ1

How much will silver be worth if the dollar collapses?.

Answers

Answer:

That is because the U.S. dollar would essentially be worthless if it were to collapse in value. In a sense, the price of silver would be infinite if measured in terms of the U.S. dollar!

How should a company adopt a data-driven culture that will stick?.

Answers

All data operations should be centralised inside a single, specialised data team. Offload data analytics to a vendor with a lot of experience. To transform the way the organization thinks about data, use change management.

Country A specializes in producing kiwis. Country B specializes in producing oranges. As a result, Country A can consume more kiwis and oranges than it could have if it had tried to grow kiwis oranges itself and had decided not to trade. This illustrates the concept of: Group of answer choices The gains of trade Absolute advantage Supply

Answers

This scenario better illustrates the concept of absolute advantage, as both countries are specialized in one product.

What is the absolute advantage?

It is an economic approach that helps to understand how a country's specialization in the production and sale of a product and service helps economic development, as there can be trade between countries with different specializations, generating funds obtained from the export of goods.

Therefore, absolute advantage helps countries to trade and develop economically.

Find out more about absolute advantage here:

https://brainly.com/question/9067127

#SPJ1

It is the end of the year and party supply stores have added the things needed for a fantastic New Years Eve party. According to the law of supply, what scenario would you expect to see with the party supply stores

Answers

The scenario that one would expect to see in the party supply stores is the supply of New Year's party supplies to have increased since November.

What is the supplies about?

In the case above, As sellers expect a lot of customers to buy party supplies the prices is said to still increase and so the suppliers are likely to increase their production rate.

The scenario that one would expect to see in the party supply stores is the supply of New Year's party supplies to have increased since November.

Learn more about supplies from

https://brainly.com/question/25843620

#SPJ1

When you purchase the exact same office supplies you purchased in the previous quarter, you are making a

Answers

When you purchase the exact same office supplies you purchased in the previous quarter, you are making a straight rebuy.

What is a straight rebuy?

This is the type of purchase that a customer is known to buy that is in the same quantity and the same terms as the goods from the same supplier.

The perfect example of this is that people are known to visit the same coffee shop daily to make the same purchase.

Read more on a straight rebuy here:

https://brainly.com/question/8530057

#SPJ1

According to the Census Bureau, in October 2016, the average house price in the United States was $28,358. 5 years earlier, the average price was $20,908. What was the annual increase in the price of the average house sold

Answers

28,358 - 20908 = 7450
7450 divided by 5 = 1490
The annual increase was 1490 per year

S. Bouchard and Company hired you as a consultant to help estimate its cost of capital. You have obtained the following data: D0 = $0.85; P0 = $22.00; and g = 6.00% (constant). The CEO thinks, however, that the stock price is temporarily depressed, and that it will soon rise to $40.00. Based on the DCF approach, by how much would the cost of equity from retained earnings change if the stock price changes as the CEO expects? Group of answer choices -1.49% -1.66% -1.84% -2.03% -2.23%

Answers

Based on the change in the stock price, the change in the cost of equity to S. Bouchard and Company would be -1.84%.

How would the Cost of Equity change?

The original cost of equity is:

22 = (0.85 x 1.06) / (cost of equity - 6%)

Cost of equity + 6% = 0.901 / 22

Cost of equity = 0.901 / 22  + 6%

= 10.1%

The new cost of equity:

Cost of equity = (0.85 x 1.06) / 40 + 6%

= 8.25%

The change is:

= 8.25 - 10.1

= -1.84%

Find out more of cost of equity at https://brainly.com/question/14041475.

#SPJ1

In the market for bottled water, fresh springs has a 30 percent share of the market, swiss springs has a 27 percent share, l'eau de france has a 13 percent share, and mountain water has a 10 percent share. the rest of the market consists of 20 firms with a 1 percent share of the market each. what is the value of the herfindahl-hirschman index

Answers

The value of the Herfindahl-Hirschman Index, calculated for the market for bottled water, is 2,298.

What is the Herfindahl–Hirschman Index?

The Herfindahl–Hirschman Index, HHI, is a commonly accepted measure of market concentration and competitiveness.

The HHI is calculated by squaring the market share of each competing firm and then summing the resulting numbers.

Data and Calculations:

Product           Market Share     Squared Market Share

Fresh springs         30%                    900(30% x 30%)

Swiss springs         27%                    729 (27% x 27%)

L'eau de France      13%                    169 (13% x 13%)

Mountain water      10%                    100 (10% x 10%)

Rest of market       20%                   400 (20% x 20%)

Sum of squared market share =    2,298

Thus, the value of the Herfindahl-Hirschman Index is 2,298, reflecting a low market concentration.

Learn more about the Herfindahl-Hirschman Index at Herfindahl-Hirschman Index at https://brainly.com/question/17180005

#SPJ1

Choosing one good or service over another based on a comparison of marginal benefits and marginal costs always involves ______. Multiple choice question. a degree of selfishness an unlimited economic resource an opportunity cost

Answers

The need to choose one goods on a comparison of marginal benefits and marginal costs always involves an opportunity cost.

What is an opportunity cost?

This refers to a value of what is rejected in order to perform the chosen alternative.

Hence, the need to choose one goods on a comparison of marginal benefits and marginal costs always involves an opportunity cost.

Therefore, the Option D is correct.

Read more about opportunity cost

brainly.com/question/12879425

#SPJ1

What is the best way to use a credit card to build your credit history?

Answers

Answer:

All you have to do is pay off your credit card bill in full and on time each month, and just keep doing that.

Explanation:

Dawn owns a hair salon and wants to open another store in the downtown shopping district. She goes to the bank to get a loan to start her business, and the bank gives her a loan that is backed by her good reputation and previous credit rating. Which type of bank loan does this scenario best describe

Answers

The type of bank loan which this scenario best describes is an unsecured loan

What is a Bank Loan?

This refers to the amount borrowed by a financial institution to a customer or individual to be repaid at a certain time.

Hence, we can see that based on the given scenario by Dawn who owns a hair salon, she collects a loan to start her business and it is backed, therefore, this is an unsecured loan

Read more about bank loans here:

https://brainly.com/question/26054995
#SPJ1

Elizabeth works for a local restaurant at the end of her shift she is required to write in the time that you arrive in the time she is leaving so that she can be paid appropriately today Elizabeth was 15 minutes late for work what would be the most ethical thing for Elizabeth to do

Answers

Answer:

Elizabeth would have to write the time she came in. If she lies, she's indirectly robbing the restaurant of it's money.

Explanation:

According to hazlitt, what should be done to help those who are hurt by economic progress? what should not be done?

Answers

For Hazlitt, there must be more production with the same workforce to achieve economic progress, generating more opportunities for individuals.

What should not be done are rules and norms that infringe on morals and ethics.

What is Henry Hazlitt's main contribution to the economy?

Through a simple and objective writing, he wrote in 1946 the book "Economy in a lesson" that instituted governmental actions and norms to achieve economic development, being a highlight of libertarianism philosophy.

Therefore, Hazlitt's ideas were focused on libertarianism, which was based on the practice of morality and freedom to build a more developed society.

Find out more about libertarianism here:

https://brainly.com/question/7068446

#SPJ1

Harry assigns his rights under a contract with irma to his college roommate, jake. neither harry nor jake notifies irma of the assignment. the assignment group of answer choices will become effective after thirty days, even if no notice is given to irma. will not be effective until notice is given to irma. is invalid. is effective immediately.

Answers

When Harry assigns his rights under a contract with Irma to his college roommate, Jake and neither Harry nor Jake notifies Irma of the assignment, it's invalid.

What is a contract?

It should be noted that a contract simply means a promise that's enforceable by law. It should be noted that a contract is legally binding.

Here, when Harry assigns his rights under a contract with Irma to his college roommate, Jake and neither Harry nor Jake notify Irma of the assignment, it's invalid. The other party was not informed.

Learn more about contract on:

brainly.com/question/5746834

#SPJ4

1. after watching the big short, do you have a clearer understanding of the wall street collapse of 2008? does the movie do a good job, or a poor one, of explaining the arcane financial devices and the ins and outs of the bond markets? did you find it interesting? or were you bored to tears?

Answers

Yes the movie big short gave a good explanation of the financial instruments that led to the wall street collapse in the year 2008.

How the movie relates to the happenings that led to the collapse of the wall street.

The writer of this movie helped to tell the story of what happened in the year 2008. He focused on the people that were behind the crash.

He used good celebrities to keep the attention of the viewer on the happenings and helped to show in good perspective all that happened.


Read more on the wall street crash here:

https://brainly.com/question/813964

#SPJ1

A customer has a margin account that shows a market value of $190,000 and a debit balance of $90,000. in addition, the account has special memorandum account of $5,000. the long market value at maintenance is

Answers

A maintenance margin is a minimum equity an investor ought to preserve withinside the margin account after the acquisition has been made. Hence,  the long market value at maintenance in this case is $120,000.

What do you mean by long market value?

Long market value at maintenance refers to the point where an account must fall (in market value) to reach minimum maintenance (25% of market value). ;

The maintenance margin is far presently set at 25% of the full value of the securities in a margin account as in step with Financial Industry Regulatory Authority (FINRA) requirements.

To calculate the long market value at maintenance,  divide the debit balance by .75 ($90,000 / .75 = $120,000)

Hence,  the long market value at maintenance is $120,000.

Learn more about long market value at maintenance:

https://brainly.com/question/15057471

#SPJ1

What was the first state to make july fourth an official holiday?.

Answers

The first state to make July fourth an official holiday is Massachusetts.

What is the significance of July fourth?

The yearly celebration of nationhood in the United States is known as Independence Day is mainly known as  July 4th. It celebrates the Continental Congress's adoption of the Declaration on July 4, 1776.

The American activist Douglass opposed the celebration as the rights of African American slaves were denied. This celebration is hypocritical and unfair according to him because it ignores a group of individuals.

He believes that as a result, Americans should be saddened, as the day serves as a reminder to all of them of the violence done against African Americans.

Learn more about July fourth, here:

https://brainly.com/question/11430576

#SPJ1

Indicate where each item would appear on a statement of cash flows using the indirect method by placing an x in the appropriate column(s). (more than one column may be used.)

Answers

The individual items that are a part of the cash flow is mentioned in the attached image by indicating X.

Operating activities are the normal duties carried out by a firm to create and sell its products, earn revenue, as well as carry out general administrative and maintenance responsibilities. Some of a company's primary operating activities include production, sales, advertising, and marketing.

One of the primary types of net cash activities that firms report on the cash flow statement is investing activities. In accounting, the term "investing activities" refers to the acquisition and disposal of long-term assets as well as other corporate investments over a certain reporting period.

Financing activities relate to agreements made between a company and its owners and lenders to obtain or recoup resources. In other words, financial activities provide the business with funding, enable debt repayment, and profit for the owners. Financing activities include giving and receiving equity.

Thus, the items of cash flow which are included has been given in the attached image by indicating in which particular head it comes.

Learn more about Cash Flow, here:

https://brainly.com/question/30066211

#SPJ12

The above question seems incomplete, probable the complete question is given below.

Indicate where each item would appear on a statement of cash flows using the indirect method by placing an X in the appropriate column(s). (More than one column may be used.) Statement of Cash Flows Noncash Investing & Financing Activities Not Reported on Statement or In Notes Operating Activities Investing Activities Financing Activities a. Declared and paid a cash dividend b. Recorded depreciation expense c. Paid cash to settle long-term note payable d. Prepaid expenses increased in the year e. Accounts receivable decreased in the year f. Purchased land by issuing common stock 9. Inventory increased in the year h. Sold equipment for cash, yielding a loss i Accounts payable decreased in the year i Income taxes payable increased in the year

Other Questions
HELP ME CJDUCIF PLEASE I WILL MARK BRAINLIST You and your family are going on afamily cruise this summer! WOO HOO!Your parents had to put down a $250deposit. Then, the cruise costs $500per person on top of that. There are 5people in your family. How much willthe entire cruise cost? Okay our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? Evaluate the following for the given values. 7xy - y + x - 1 for x = -2 and y = -1 Which term matches the picture? What hint does the author of how to jump start a battery give for remembering that you should connect the positive clamp onto the battery before the negative clamp Who created the Universal Declaration of Human Rights?Select one:a.Pierre Elliot Trudeaub.UN General Assemblyc.Lester B. Pearsond.Amnesty International Which associations best describe the scatter plot?Select each correct answer.Positive associationNegative associationLinear associationNonlinear association Escribe canciones originales. PLEASE HELP!!!! Which of the following scenarios is related to ethical issues?O A. A client confides to a nurse aide that her parents physically abuse her.O B.A nurse aide notices cigarette burn marks on a client when helping her dress.O C.A nurse aide sees her colleague stealing drugs from the healthcare facility.OD. A nurse aide does not properly sterilize medical equipment so she can leave early.OE. A nurse aide avoids attending to clients from a particular socio-economic background.UndoNext The quarks that compose a baryon may have charges of:. If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals.