Look at the frame from Iqbal.

An announcer says, "The Youth in Action Award for human rights is given to Iqbal Masih!"

Read the excerpt from the prologue of Free the Children.

Later that year he arrived in Boston to receive the Reebok Youth in Action Award.
Holding a pencil in one hand and a carpet tool in the other, Iqbal stood before the audience. And in his small but commanding voice he spoke of the horrors of child labour. The room was intensely silent.

Which statement best describes a difference between the frame and the excerpt?

Only the excerpt mentions the award Iqbal received in Boston for his work to liberate children.
Only the excerpt shows what the podium looked like before Iqbal gave his speech.
Only the excerpt tells about the atmosphere in the room after Iqbal received the award.
Only the excerpt describes the look on Iqbal’s face when his name was announced.

Answers

Answer 1

Answer:

c) Only the excerpt tells about the atmosphere in the room after Iqbal received the award.

Explanation:


Related Questions

Write the introductory paragraph of a report on an accident involving a cyclist that occurred on your street.
I’ll give brainlest please

Answers

Answer:

On october 19, 2020 a cyclist was hit by a car,he had to be in the hospital for about a year. Now that he is out he is going to sue to get money for his hospital damages.

Explanation:

WILL GIVE BRAINLIEST!! NEED HELP ASAP!!!! Which is an example of juxtaposition from Roll of Thunder, Hear My Cry?
A) the ways in which Cassie and Mama react to injustice
B) the suspense that is created after Papa gets shot
C) the attitude that Little Man has about the offensive school books
D)the scenes in which the children encounter the school bus

Answers

My opinion is A so A

Read the sentence from “Broken Chain.”

The next day he spent his lawn-mowing money on a new shirt and, with a pocketknife, scooped the moons of dirt from under his fingernails.

The descriptive language shows that

Alfonso's fingernails are white.
the dirt has a curved shape.
Alfonso gets very dirty at work.
lawn mowing is a profitable job.

Answers

Answer:

its b

Explanation:

the dirt has a curved shape.

The descriptive language from this question is that the dirt has a curved shape.

What is a descriptive language?

This is a language that is used to describe vivid and also specific details. The vivid detail here is about the dirt.

The description of the dirt as a moon of dirt makes b the answer. This is because the moon has a curved shape.

Read more on descriptive language here:

brainly.com/question/14775032

How does Gregor try to stop Grete from removing the picture of the woman
from his room?
A. By throwing it under the couch
O B. By covering it with his body
O C. By hissing and snapping at Grete
O D. By covering it with the bed sheet

Answers

In Franz Kafka's Metamorphosis, the picture of Venus in Furs hanging from the wall of Gregor symbolizes the past that he holds, desiring wealth and beauty. When her sister and mother try to remove the objects from the room, Gregor stops her sister removing the picture by clinging to it. The picture is his last destination for his past like a drug for a drug-addict. It is a last element from his life before the transformation.

By covering it with his body Gregor try to stop Grete from removing the picture of the woman from his room. hence the option B is correct.

What's the story of Royal House of Thebes?

In "The Royal House of Thebes," Creon's most villainous action is his decision to sentence Antigone to death for burying her brother, Polynices, against his decree.

Creon's inflexibility and pride lead him to defy the gods and the laws of nature, as well as to disregard the advice of his son, Haemon, and the chorus of elders who warn him against his course of action.

Creon's stubbornness and unwillingness to listen to reason ultimately result in tragedy, as Antigone and Haemon both take their own lives, leading to the downfall of Creon's own house.

Creon's actions demonstrate his arrogance, cruelty, and disregard for human life and justice, making him a villainous character in the story.

Learn more about the story of Royal House of Thebes here :

https://brainly.com/question/11495104

#SPJ7

How is publishing on a blog different from publishing in an online magazine or journal?

Answers

So, depending on how much you trust the authors of your blog, you can grant them any permission you like.

A magazine sets its standards more strictly. To maintain the direction and style of the publication, editors thoroughly review every piece.

Answer:

a blog is where you post daily news and continue to post content for other wise a magazie  is more on facts or clothing and news and a jornal  is  simillar  

Explanation:wither in a blog you post evething and every detail.

Which phrase best explains the kind of words the writer uses to affect the reader? mainly words with strong positive connotations mainly words with strong negative connotations mainly words with neutral and positive connotations mainly words with positive and negative connotations

Answers

Answer:

Mainly words with positive and negative connotations

Explanation:

This way, the words will be balanced.

The phrase that explains the kind of words the writer uses to affect the reader is B. mainly words with strong negative connotations.

The author stated that violence in video games was essentially to blame for the violence that we have in society.

It was stated that when children are bombarded with monstrous images, they start and think that such actions are normal and behave based on what they see.

Therefore, words such as monstrous and violence indicate negative connotations.

Read related link on:

https://brainly.com/question/19069681

Which two steps are most necessary to make an inference?

anticipating opposing viewpoints
researching unfamiliar vocabulary
locating key details in the text
connecting details to your outside knowledge
discussing the text with a peer

Answers

Answer:

"Locating key details in the text" and "anticipating opposing viewpoints are two most necessary steps to make viewpoint."

Explanation:

"Locating key details in the text" and "anticipating opposing viewpoints are two most necessary steps to make viewpoint."

What is inference?

An inference is a method of deduction that entails using information that is already known to make educated assumptions about information that is still unknown. Inference is a tool that is frequently used in daily life to extrapolate facts.

For instance, if it is winter and there is snow on the ground, one may assume that it is necessary to put on a coat before going outside because it would probably be chilly.

People can draw logical conclusions from evidence by using inferences. A literary inference is something discovered by combining the reader's prior knowledge, the historical setting, and what is known about the author.

Therefore, "Locating key details in the text" and "anticipating opposing viewpoints are two most necessary steps to make viewpoint."

To learn more about inference, refer to the link:

https://brainly.com/question/11986000

#SPJ3

Read the excerpt from Warriors Don't Cry.

Cameras flashed, bright lights stung my eyes, and reporters asked lots of questions for the next half hour. Many of the reporters asked the attorneys what they planned to do to get rid of the troops. And questions were directed to Elizabeth. She seemed shy about answering, but with Mrs. Bates's help, she forced herself to say a few words. Eventually, however, questions were directed to all of us. My heart raced with fear and anticipation as I observed the process. I was almost hypnotized by the wonder of it all.

What is the author’s purpose for including these details?

to describe her personal recollections to readers
to entertain readers with a humorous story
to explain the injustice of segregation to readers
to persuade readers of the importance of youth activism

Answers

Answer:

The author’s purpose for including these details is:

A. to describe her personal recollections to readers.

Explanation:

In "Warriors Don't Cry" Melba Patillo Beals narrates the true story of the group known as the Little Rock Nine. Beals and the other eight African Americans part of the group were the first black people to attend Little Rock High School, in Arkansas.

This particular excerpt from the story has the purpose of presenting Beals's personal recollections to readers. Notice how she focuses on how she felt, on how the whole experience was new and impressive to her. Even though the book itself speaks of injustice and the importance of activism, this passage concerns Beals's personal experiences, feelings, and thoughts - "My heart raced with fear and anticipation as I observed the process. I was almost hypnotized by the wonder of it all." Therefore, the best answer is letter A. to describe her personal recollections to readers.

Answer:

A

Explanation:

just took the test

Who do you consider an intellectual person? It can be someone you know, someone famous, someone from history, or even a fictional character. Try to list as many as you can.

Answers

Answer:

I consider my father an intellectual person.

He is intellectual in every sense of the word as he is not only book smart, but smart in the way how things of the world works.

He knows a bit about everything. He can fix an engine, build a dog house, nurse an injured bird back to health, he is great with kids, he has an analytical mind, etc.

He uses his intellect very well to solve daily problems.

Text is Advice To the Newly Married Lady.

What view or belief about women does the author convey in this sentence: “Your house is your only refuge, your husband your only companion”? (Paragraph 3)

A. Women had incredible freedom and rights.

B.Women could only be wives and manage homes.

C.If things were bad at home, a woman had no other options.

D.If a woman wanted a good life, she had to buy a home.

What is the answer?

Answers

Answer:

C

Explanation:

why does candy relate to his old dog so much

Answers

Answer:

didnt understand what u meant but

Candy's dog represents the fate awaiting anyone who has outlived his or her purpose during the time the novel was set (1930s). ... Candy's dog was originally a useful addition to the ranch however due to old age the dog is now viewed as useless

Explanation:

Answer:

Explicanda sympathizes with his old dog because he is in a similar situation. Candy understands that he is also past his prime and can be disposed of at any time. His reluctance to end his dog's life parallels his fate. Candy does not want to be let go, in the same way that he does not want to shoot his dog.   nation:

Read the excerpt below and answer the question.

"God bless me!” said Sancho, “did I not tell your worship to mind what you were about, for they were only windmills? and no one could have made any mistake about it but one who had something of the same kind in his head.”

“Hush, friend Sancho,” replied Don Quixote, “the fortunes of war more than any other are liable to frequent fluctuations; and moreover I think, and it is the truth, that that same sage Friston who carried off my study and books, has turned these giants into mills in order to rob me of the glory of vanquishing them, such is the enmity he bears me; but in the end his wicked arts will avail but little against my good sword."

The tone of this excerpt can best be described as _____.

confrontational
pessimistic
ironic
sentimental

Answers

Answer:

I think pessimistic but. not completely sure

PSYCHOLOGY Airborne chemical substances travel up the nose to the olfactory __________, which is the receptor for smell. A. Cilia B. Cortex C. Bulb D. Base Please select the best answer from the choices provided A B C D

Answers

Answer:

C. Bulb

Explanation:

Our sense of smell is totally dependent on the olfactory bulb. That's because we can smell things, it is necessary that the chemical substances responsible for the fullness are transported by air to our nose, which captures them and takes them to the responsible cells for receiving electrical signals that take these signals to the glomeruli where the olfactory bulb is located, which is the primary olfactory area of our brain.

Choose the best way to revise the underlined part of the sentence. Your choice should make the most effective sentence and express the meaning of the original sentence. If no revision is needed, choose A, which repeats the original underlined sentence part.


By routing the new highway around the town instead of through the middle of it, the governor prevented an excess of traffic noise, this was a concern of the townspeople.


a. By routing the new highway around the town instead of through the middle of it, the governor prevented an excess of traffic noise, this was a concern of the townspeople.


b. it was though by the townspeople to be a concern


c. because the townspeople had concerns


d. a concern of the townspeople


e. being the concern the townspeople were having

Answers

Answer:

The best way to revise the sentence is the one expressed in letter D. a concern of the townspeople.

Explanation:

First, let's ask this question to the sentence: What was the concern of the townspeople? That there would be an excess of traffic noise. This information is given immediately before we learn that the townspeople were concerned about it. Thus, we can transform the last clause, "this was a concern of the townspeople," into an appositive. By doing so, we connect the last clause to the rest of the sentence in a simpler yet effective manner. It's as if we are simply adding an extra information to what we already know:

By routing the new highway around the town instead of through the middle of it, the governor prevented an excess of traffic noise, a concern of the townspeople.

Answer:

the answer is A

Explanation:

The same it say but it a little diferent but guaranteed it is the answer

Which of the following is the best definition of an opinion?
a. Information that cannot be proven true or false. c. Something that is not researched,
b. Information that is incorrect.
d. An argument.

Answers

Answer:

A

Explanation:

Dogs are cute. You can't prove that it's true, (I wish) but you can't prove that it's false either.

6. Read the sentences: "She'll be purple!' cried Mr Wonka. 'A fine rich purple from head to
toe! But there you are! That's what comes from chewing disgusting gum all day long!"
Based on this information, it can be concluded that? *

-Violet will be perfectly normal.
-Violet will be purple for the rest of her life.
-Violet will be fat but normal.
-Violet will not survive.

Answers

Answer:

Violet will be purple for the rest of her life.

Correct me if I am wrong.

Which option uses capital letters correctly?


"High above us was a roaring sound," she said. "It was terrifying!"


"high above us was a roaring sound," she said. "It was terrifying!"


"High above us was a roaring sound," she said. "it was terrifying!"


"High above us was a roaring sound," She said. "It was terrifying!"

Answers

Answer:

A

Explanation:

Dialogue tags are only capitalized if they begin with a proper noun.

Answer:

The Third Option

Explanation:

Because it uses correct capital letterts

if you have read mice and men, please help me

Answers

Answer:

C, B

Explanation:

What are the advantages of too much screen time

Answers

dude there is nun, im being fr

Answer:

can teach you new things, school-related homework and research. playing video games can improve kid's motor skills and coordination. texting and video games with friends are easy and fun ways to socialize and communicate with others. healthy eyes and fewer headaches, learn important skills in life

Explanation:

Can someone give me ideas for writing an essay about I want to be....
i don't want the whole thing I just need ideas.

Thank You.

Answers

Answer:

I WANT TO BE...

-A STRONG PERSON/ AND WHY

-KIND TO OTHERS

-A DOCTOR/WHY

Explanation:

Answer:

Sure

Doctor, Vet, Firefighter, Lawyer, Chef, Teacher, etc....

Explanation:

Essay has to have a hook so like for example if you want to be a doctor. Start the essay with someone being raced to the hospital. Then you can have your beginning about What profession you chose, What do you do in the profession, how much you make.

2nd part can be about people you know who are in this profession, how this profession benefits you or the community, if you have to go to college or not.

3rd part can simply be the reason why you want to pursue this profession so bad, and what skills you need to be successful.

Hope this helps!!

There was a ironic tone to the message as if the speaker found it amusing and Jonas had a smiled a little though he knew what a grim statement it has been

Answers

The original question is:

There was an ________ tone to that final message, as if the Speaker found it amusing; and Jonas had smiled a little, though he knew what a grim statement it had been.

Answer:

ironic

Explanation:

The irony in a text happens when a character says one thing, which actually means another. This can be seen in the excerpt above, where the speaker delivered a message as amusing, but it was a dark and unsettling message, but he used irony to speak in a fun and animated way.

In a drama script, stage directions are provided in order to

help the actors find their way to the theater.
help the audience understand what the play is about.
tell the actors how to dress and move for the characters.
tell the audience more about the characters.

Answers

Answer:

Tell the actors how to dress and move for the characters.

Answer:

C it makes sense

1. ______’s this called in English?
2. ______ book did you buy?
3. _____ doesn't understand what the teacher has explained?
4. _____ children are they? – The Browns’.
5. _____ are you learning now?
6. _____’s the weather like today?
7. ______ do you prefer: ''U2'' or "AC/DC"?
8. _____ does she do for a living?
9. _____ do you know about this subject, and who taught it to
you?
10. _____ is the longest river in the world: the Amazon or the
Nile?

Answers

What's this called in English?What book did you buy?Who doesn't understand what the teacher has explained?Who's children are they?What are you learning now?What's the weather like today?What do you prefer: "U2" or "AC/DC"?What does she do for a living?What do you know about this subject, and who taught it to you?What is the longest river in the world: the Amazon river or the nile river?

why does the speaker fight his friend in the poem fight by Montague ​

Answers

Answer:

Because he thinks that his vision is wrong

Explanation:

Because he did not say it correctly

Which sentence BEST describes the process of drawing conclusions based on the information in a table?
Notice your emotional reaction to data in the table.
Evaluate the accuracy of the information displayed.
Decide what broad statement the data supports.
Agree to be persuaded by the writer’s argument.

Answers

Answer:

Evaluate the accuracy of the information displayed.

Explanation:

You wouldn't want to be opinionated to draw conclusions, they should be based on accurate facts. A and D are emotional processes that really have nothing to do with drawing conclusions from data, and C is a little too vague.

Answer:

Decide what broad statement the data supports.

Explanation:

sorry if wrong

Choose a character that you enjoyed reading about from a story or a drama. Which character did you choose? Why do you like this character?

Answers

Answer: To All the Boys I've Loved Before

Explanation: it's a  great book and movie

Subcribe to Mr.Beast now or else
this is just a excuse to give 100 points and brainiest to whoever says something first.

Answers

Ok

:3

jjsjsjsjsjsjsjjssjsjjsjsjsjsjsjsj

Answer:

What if we are already subscribed?

Explanation:

(I know this is sooooooo late but who cares)

heyyy I need the answers for lunch around the world on read works ​

Answers

Answer:

What’s the question tho

Explanation:

What does bradbury say about trchnology in the beginning of the story?
Btw the story is The Velt

Answers

Answer:

Bradbury presents a cautionary tale of how technology can completely consume a household and drive a significant wedge between parents and children.

Explanation:

hope that helpes,brainliest?

how long will it take to fill the tank with 40 gallons of water ?
explain responds

Answers

Um well if you was more clear on the question and told use all the information we could tell you cause we can’t with out the other information

Answer:

Depends on water pressure, but it should completely fill in1 5-20 minutes. The water should be hot in another 20-25 minutes if it has been run completely empty.

Explanation:

Other Questions
compare endocytosis and exocytosis. ( one similarity and one difference) what chapter was it when christfer colubus saild the alantic sea Which ordered pair is a solution of the equation -4x + 7 = 2y - 3 which set of the numbers is equivalent to 75%? (0.75 3/5), (7.5 75/100), (3/4 0.075), (15/20 0.75) Identify the independent variable (domain). 5x+2y= 150 I WILL GIVE A LOT OF EXTRA POINTS. PLEASE ANSWER ALL OF THEM The manufacturers of can of salted mixed nuts state that the ratio of peanuts to other nuts is 6 to 5 . If 414 peanuts are in a can how many other nuts should also be in the can (8,9), X + 8y = 9Help me please What is 15% of 140? A.2,100 B.30 C.21 D.119 What was a vassal required to pay to their lord? crops money land tares Helppp ASAP. Emma wants to enlarge a square photo and print it to a square canvas. The sidelength of the canvas is 12 in. The scale from the canvas to the photo is 4 in. to 1 in.What is the side length of Emma's photo? Show your work. What other story element is most affected by the narrator's point of view?A) the story's titleB) the story's settingC) the story's theme Express the recurring decimal 0.56 (Just the 6 is recurring) in its simplest form. What should you ask yourself before you post a photo, video, or other information about another person online? 1. la seora Trevio tiene el doble de edad que suhijo hace 9 aos la suma de su edades era 30cual es su edad actual? ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut Philosophies born out of ancient China include____.A. BuddhismB. DaoismC. JainismD. Hinduism On a map, the distance between NY and Washington D.C. is 3.6 inches. The scale is 1 inch: 55 miles. What is the actual distance between the two cities? 31. The observed regularities in the properties ofthe elements are periodic functions of their(1) atomic numbers(2) mass numbers(3) oxidation states(4) nonvalence electrons Which describes an altocumulus cloud?a.high, feathery cloudc.low storm cloudb.puffy mid-level cloudd.high cloud made of ice crystalsPlease select the best answer from the choices providedABCD