kierra is a young, single parent who is emotionally distant to her children. when she does interact with them, she often gets frustrated and sends them away from her. what type of attachment are her children likely to form

Answers

Answer 1

In a case whereby kierra is a young, single parent who is emotionally distant to her children. when she does interact with them, she often gets frustrated and sends them away from her the type of attachment that her children likely to form is Avoidant.

What is Avoidant attachment?

Avoidant attachment is an attachment style  that can be attributed to the child  when their parent or main caretaker doesn't show care or responsiveness past providing essentials like food and shelter.

It should be noted that the child do disregards their own struggles as well as needs in order so that they can maintain peace and keep their caregiver close by howevr this style can be seen in the way they keep distance from others as well as push others away when they get close or show a desire for closeness and their lack of emotional closeness in relationships.

Learn more about Avoidance at:

https://brainly.com/question/25771019

#SPJ1


Related Questions

1. What kept John White from returning to Roanoke for nearly three years?
a. the collapse of the English economy
b. the defeat of the Spanish Armada
c. fighting between England and Spain
d. his poor health

Answers

Fighting between England and Spain if you want ask me another questions and I’ll
Try to help ❤️❤️

"The second world war was inspired by the feeling of revenge". Justify the statement on the basis of causes in seven points.​

Answers

Answer:

Yes.

Explanation:

Yes, the second world war was inspired by the feeling of revenge because in the first world war, very strict rules were applied on the Germany by the other nations and Germany lost its many territories. So that's why the Germany started the second world war to regains its land and to rule over the European countries. The main causes of second world war are the impact of the Treaty of Versailles after first world war, the worldwide economic depression, failure of appeasement, the rise of militarism in Germany and Japan, and the failure of the League of Nations to maintain world peace.

If you were put in charge of reducing obesity in the world, what would you suggest doing to reduce the rates of obesity? Why would you suggest these actions?
please answer

Answers

Answer:

I would suggest to ration the meals so that losing weight is possible. I would suggest these because everyone is just getting food, no one is putting a limit to it.

Explanation:

I would high up the amount of exercise and diet foods

Why do you think it took almost a century for another African American to be elected to the Senate?

Answers

Answer:

the most likely reason is because people hate on others because there religion color of there skin and  alot of other things people just dont know how to like a person for who they are and that is why teh world is so messd up to this day

Explanation:

Where do a majority of the tobacco farmers live in Southern Africa?

Answers

Answer:

I would say Malawi because Southern Africa's biggest tobacco imports are from there

Explanation:

Drag each tile to the correct box.
Match each nongovernmental organization with the correct description of how it uses people's donations.

to provide health care to people in conflict zones and poverty-stricken areas
to fight for the rights of the wrongfully imprisoned
to provide disaster relief around the world
to support environmental causes
Amnesty International
arrowRight
Greenpeace
arrowRight
Red Cross
arrowRight
Doctors Without Borders
arrowRight

Answers

Answer:

Amnesty International - fight for the rights of the wrongly imprisoned (number 2)

Greenpeace - to support enviromental causes (number 4)

Red Cross - disaster releif (number 3)

Doctors Without Border - provide health care... (number 1)

Explanation:

Hope this helps!

DUE IN 7 MINUTES PLEASE HELP ASAP
What Although the Black Death was a tragedy, what do you think were the positive effects?

Answers

Answer:

People abandoned their friends and family, fled cities, and shut themselves off from the world.

Explanation:

The black death saw positive effects such as modern labor movements, and due to population control, there was more food, more land, and improvements in medicine.

How old was geroge washington when he become president?

Answers

Answer:

57

Explanation:

Hope this helped!

Answer:

he was 57 years old

Explanation:

hope it helps ! have a great day!

PLS HELP:)
Which of the following supporting details would best support an expository
essay section titled "Causes of the Great Depression"?
A. What the nation needed as a remedy was a large-scale
mobilization of working-age Americans and a kick start to
industry, and World War Il provided exactly that.
B. The period was the source of many famous pieces of art and
literature, including Dorothga Lange's photograph, "Migrant
Mother," and John Steinbeck's Grapes of Wrath.
C. The stock market crash of 1929 and the wide-scale bank failures
of the early 1930s led most Americans to stop purchasing goods,
and the economy effectively ground to a halt.
D. The Great Depression was the reason the greatest set of public
works programs in our nation's history - the New Deal - became
a reality, and just in time.

Answers

Answer:

C

Explanation:

Umm...a picture might send a wrong message..not sure you want that

Have an amazing night ❤️

Answer:

Yes, It is C

Though it is C may I just say that beautiful young lady is quite the view

which map best represents georgia legation in the southern united states

Answers

Answer:

Georgia is located in the southern hemisphere on the north American continent.

Explanation:

18. Paris tends to view personality as fairly stable and therefore her personality is more stable, whereas Lane
tends to view personality as fairly changeable and therefore her personality is more changeable. These
differences in attitudes and personality are most consistent with the


need help asap☝

Answers

Answer: social cognitive view of personality

Explanation:

What are the duties of the attorney general? Check all that apply. defending the laws of the state in court being responsible for the custody of state funds keeping the Great Seal of the State of Louisiana serving as the head of the Department of Justice advising or assisting on criminal cases as needed serving as an ex officio member on certain committees​

Answers

Answer:

ADE

Explanation:

Answer:

The answer is ADE on edg

Explanation:

The data could be used to support which conclusion?
A.Gulf Coast states had to rely on steamboats to transport goods
B.States in the lower South had more land devoted to plantations
C.Border states had to import needed raw materials
D.States in the upper South were heavily industrialized ​

Answers

Answer:

D. States in the lower South had more land devoted to plantations.

Explanation:

1. which of the following is true about the religious practices of ancient china and the ancient indus valley civilization?

a: they worshipped the same gods.
b: they built pyramids.
c: they were polytheistic.
d: they were monotheistic

2. which of the following statements is true about chinese contributions?

a: ancient china had limited resources and made few contributions that are remembered today.
b: ancient china made many contributions to math, science, and the arts.
c: most contributions of ancient china were related to agriculture.
d: most contributions of ancient china were related to war.

Answers

Answer:

Early Humans: Survival and

Settlement

How do environmental

changes impact human life and

settlement?

X X

The Ancient River Valleys:

Geography and Civilization

How do geography and

environment impact

civilization?

X X

Ancient Greece and Rome:

Common Rule and

Government

What factors make a

civilization influential? X X X

Civilizations in Africa and

Asia: Expanding Trade

Is trade necessary for

advancing civilizations? X X

Medieval Europe and the

Renaissance: Legacy

What makes civilizations

regress and how do they

renew themselves?

Explanation:

Answer: They were both polytheistic sorry if I'm late or if it's wrong! If its wrong give the other guy brainiest! :)

Explanation:

Which organization did African-Americans help form throughout the South during Reconstruction

Answers

The freedmen Bureau (if I am wrong sorryyy)

Which SE Asian country is closest to having a pure command economic system? *

Answers

Answer:

North korea

Explanation:

i don't know

Answer:

North Korea

Explanation:

https://www.enotes.com/homework-help/what-countries-use-command-economies-515825

Also looking at the wprld map you would see that north korea is a long the SE part of the world

Can you pls do this for me

Answers

Answer:

"Do you ever wonder where cats go when they die?" queried Bradly.

Explanation:

I'm pretty sure this is right but I may still be wrong.

Answer:

"Do you ever wonder," queried Bradly, " Where cats go when they die?"

Explanation:

also who spells Bradley without an e

How did the distruction of bison herds impact Native Americans?

Answers

The Plains Indians were almost totally dependent upon the bison. They were a source of food, shelter, utensils, and clothing and most importantly spiritual strength. The American bison sacrificed its life to keep the American Indian in existence.

Which of the following is a difference in the outcome of the distribution of seats in the United Kingdom and
Nigeria in 2018?
O In the United Kingdom the Labour Party was part of the ruling government, and in Nigeria the APC was part of the ruling
government
O A minority coalition government ruled in the United Kingdom, and a single-party majority government ruled in Nigeria
The majority party in each country formed a government
O In both countries small parties received a large percentage of the vote but received relatively few seats.

Answers

Answer:

O A minority coalition government ruled in the United Kingdom, and a single-party majority government ruled in Nigeria

How are the concepts of race and ethnicity the same?
A. They are ways of categorizing people.
B. They are based on genetic patterns.
C. They are based on physical traits.
D. They are ways of socializing people.

Answers

A. They are both ways of categorizing people

volcanoes are described according to their shape and type of eruption​

Answers

Answer:

Definition: A volcanic eruption occurs when magma is released from a volcano. Volcanic eruptions can be quite calm and effusive, or they can be explosive. Effusive eruptions produce lava flows, while explosive eruptions produce ash and pyroclastic density currents.

Explanation:

Definition: A volcanic eruption occurs when magma is released from a volcano. Volcanic eruptions can be quite calm and effusive, or they can be explosive. Effusive eruptions produce lava flows, while explosive eruptions produce ash and pyroclastic density currents.

As you read the following scenario, think about how the government is involved in what Kimberly uses and
encounters.
Kimberly has just left her job after a long day and is heading to the airport to go out of town for the weekend.
She gets in her brand-new car and heads for the interstate. As soon as she gets on the interstate, she realizes
that there is more traffic than usual. So, she turns
on the radio to hear the traffic report. Later, she realizes that
she's running out of fuel and stops at a gas station. She uses her credit card to pay for the gas. Expecting more
traffic, she runs into the gas station and buys bottled water by paying cash. She reaches the airport barely on
time and quickly goes through the security checkpoint. Finally, she boards the plane and, given her hectic day,
falls asleep before takeoff.
List all the ways the government was involved in Kimberly's evening activities.

FROM PLATO ECON

Answers

Answer:

In this particular activity, Kimberly encountered various things and services controlled by the government in various ways.

The airport is under the aviation department of the government

A new car is personal property that is protected under government property rights.

The government provides public goods, such as highways so the interstate road is under this

The Federal Communications Commission regulates airwaves and spectrum for TV and radio. the government ensures consumer protection such as credit card information.

The government issues currency so cash is also a government asset.

Fuel is also regulated by petroleum authorities of the government. The Food and Drug Administration regulates bottled drinking water.

The Federal Aviation Administration regulates commercial aviation controls air flight. The Transportation Security Administration manages national security such as airport security

One possible answer may look like this:

new car—The government protects her property rights.
interstate—The government provides public goods, such as highways.
radio—The Federal Communications Commission regulates airwaves.
credit card—The government ensures consumer protection.
cash—The government issues currency.
bottled water—The Food and Drug Administration regulates bottled drinking water.
airport security check—The Transportation Security Administration manages national security.
airplane flight—The Federal Aviation Administration regulates commercial aviation.

Edmentum sample answer

Abilities a learner applying for studies in heritage related programmes must have​

Answers

Answer:

if you get this answer tell me

A learner applying for studies in heritage-related programs must have​ two abilities: curiosity and patience.

What is a cultural heritage Program?

The curriculum focuses on developing skills for evaluating intangible heritage, such as customs, languages, and knowledge, as well as an environmental heritage related to interactions between humans and nature. Tangible heritage includes things like buildings, monuments, archaeological sites, and works of art.

The Department of Medieval Studies is home to the Cultural Heritage Studies Program, which combines theoretical and practical education by providing a range of theoretical and methodological approaches with a strong emphasis on fieldwork, internships with local, regional, and international heritage organizations, and practical knowledge and skills.

The program's graduates will be qualified to work in a variety of management and research positions related to cultural heritage and resource preservation and management. A program committee made up of members from several academic institutions and disciplines develops and oversees it.

Learn more about the cultural heritage Program here:

https://brainly.com/question/17152413

#SPJ6


Describe the biopsychosocial model of explaining psychological disorders, and the factors that influence it. How does this
view offer a broader understanding of disorders?

Answers

Answer:

The biopsychosocial model views health and illness behaviors as products of biological characteristics, behavioral factors, and social conditions. Biological conditions are things such as genes. Behavioral factors are things such as lifestyle, stress, and health beliefs. Social conditions are things such as cultural influences, family relationships, and social support. This view broadens the view of mental illnesses because it shows there are many factors the can affect ones mental state and well being.

Explanation:

This is what i put edge 2020

Answer:

I know this is late but if anyone needs it still

Explanation:

The biopsychosocial model explains that psychological disorders can be caused by many aspects of one's life. This may include physical problems, past or present experiences, bad habits, their interpretations, or difficulty in their environment. This model offers the idea that mental disorders can be affected by biological, psychological, and social-cultural influences. Biological influences may be things like evolution, individual genes, or brain structure and chemistry. Psychological influences may be stress, trauma, learned helplessness, or mood-related perceptions. Social-cultural influences could be roles, expectations, and cultural definitions of normality and disorder. These social-cultural influences would be different for those of different cultures. The biopsychosocial model offers a broader understanding of disorders because it opens up more possibilities for treatment. Using this model, doctors can account for all possibilities that may be affecting one's mental state and attempt to treat them by addressing this. The biopsychosocial model encourages patients to work with doctors on treating their own disorders. 

Earths structure


what is the best definition for crust and best sentence

Answers

Answer:

The solid outer shell of the earth, with an average thickness of 30–35 km in continental regions and 5 km beneath the oceans, forming the upper part of the lithosphere and lying immediately above the mantle is called crust.

A loan that is backed by collateral is __________. A. secured B. high interest C. unsecured D. interest free Please select the best answer from the choices provided A B C D

Answers

Answer:

A

Explanation:

My answer is right because the loan paid by force that if it is not paid the loaner would still have the collateral so he is secured about his payment

A loan that is backed by collateral is secured. Therefore option A is correct.

What is Loan?

A loan is a type of deficit that a person or other entity incurs. The lender advances the borrower a certain amount of money, typically on behalf of the industry, financial institution, or government. The borrower accepts a specific set of terms in return, which may include any financial costs, interest, a repayment schedule, and other requirements.

Before any money is sent, the lender and borrower must agree on the terms of the loan. The loan document will specify any instances where the lender may ask the borrower to pledge an asset as security. A mortgage is a frequent loan taken by American households to pay for real estate.

In addition to secured and unsecured loans, conventional loans also come in open-end and closed-end varieties.

To learn more about Loan follow the link.

https://brainly.com/question/11632219

#SPJ5

The Department of Defense is actively invested in improving combat rations.

True
False

Answers

True :)
I think thats the right answer.

Dungoose answer this

Thank you so much for all the help I rly needed it I cannot explain how much you helped me your awsome:)) (also I couldn’t put all 112 points because it only ;et me put 100 and I’m pretty sure she these get poster it splits the amount of points I put into it)

Answers

Glad I could help see you tomorrow

Answer:

before you report me, for taking points, remember i was the one who helped you a lot and you said that you would give me more points when you had them?

Explanation:

Ok we even now

2. During the Vietnam War in the 1960s and early 1970s, Americans who opposed the war
sometimes expressed their views by burning the United States flag. Many Americans were very
offended by this act of protest. Write a sociological description of flag burning. Use the following
terms in your description:
• Deviance

Answers

Answer:

The Court has recognized that the First Amendment protects certain forms of symbolic speech. Flag burning is such a form of symbolic speech. When a flag is privately owned, the owner should be able to burn it if the owner chooses, especially if this action is meant in the form of protest.

Explanation:

Hey mate, here's your answer....

What was the cause of labor reform movements in the early 1800s

Answers

Answer:

The labor movement in the United States grew out of the need to protect the common interest of workers. For those in the industrial sector, organized labor unions fought for better wages, reasonable hours and safer working conditions.

Other Questions
Oxalic Acid, a compound found in plants and vegetables such as rhubarb, has a mass percent composition of 26.7% C, 2.24% H, and 71.1% O. Oxalic acid can interfere with respiration and cause kidney or bladder stones. If a large quantity of rhubarb leaves is ingested, the oxalic acid can be toxic. The lethal dose (LD50) in rats for oxalic acid is 375 mg/kg. Rhubarb leaves contain about 0.5% by mass of oxalic acid. (Show your work, using the insert equation tool :) What is the empirical formula of oxalic acid PLEASEPLEASE ANSWER and if i get any more bots answering with links im gonna cry ive put this question 5 times Study the image, and then choose the statement that best describes the image. OohBalloons are deflatin'Guess they look lifeless like meWe miss you on your side of the bed, mmmStill got your things hereAnd they stare at me like souvenirsDon't wanna let you out my headJust like the day that I met youThe day I thought foreverSaid that you love me But that'll last for neverIt's cold outsideLike when you walked out my lifeWhy you walked out my life?I get like this every timeOn these days that feel like you and meHeartbreak anniversary'Cause I remember every timeOn these days that feel like you and meHeartbreak anniversaryDo you ever think of me? If the driver slammed on the brakes, what could happen to the crate? If aluminum nitrate reacts with calcium phosphite, what is the balanced coefficient of aluminum nitrate? how do child laborers compare to child slaves from chocotate from children Ms. Morrison is purchasing a house and needs to finance a $150,000 mortgage fromthe bank with an annual percentage rate (APR) of 3.8%. She is financing it over 30years and making monthly payments. What is the monthly payment? Samantha and Luis are attempting to dentermine the average number of library books that seventh-grade students check out at one time. Samantha surveys every other seventh grade students GIVING BRAINLIEST PLEASE HELP!!-if you answer correctly ill give you brainliest which will give you 23pts- what is parallel to y=5x + 3 virtual libraries present new paradigm for learning in school library change that sentence to present continuous tense How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT help please !! i need help The area of a rectangle is 46 square inches. If the length is 4 times the width, thon findthe dimensions of the rectangle. Round off your answers to the nearest hundredth Nicole had 8 correct answers on her math test. There were 20 total questions. Enter the percent of the correct answers Nicole had. What is the slope of the line below?The image is a graph of an x-axis and a y-axis. A line is drawn which passes through the points (2,3) and (-2,-7). A. 5 B. 0.2 or 15 C. 2.5 or 52 D. 0.4 or 25 which inequality is true? lol please do it correctly, brainliest if right please dont post links no bots A city has a population of 340, 000 people. Suppose that each year the population grows by 3.75%. What will the population be after 10 years ? Use the calculator provided and round your answer to the nearest whole number.