Answer:
See the answer below
Explanation:
Jimmy was right to say organisms grow because their cells grow.
The growth of organisms can happen in terms of an increase in the number of cells they have (through mitotic cell division) or an increase in the volume of the cells with or without an increase in the number of cells.
A good example is found in plants, most of which undergo an increase in size without any increase in the number of cells in their bodies. The uptake and storage of water in the vacuole produces a pressure that pushes on the cell walls, causing an increase in length, girths, and other growth features of the cells of plants.
Which of the following is a requirement for a population to be in Hardy-Weinberg equilibrium?
A) The population must be very small
O
B) immigration must outpace emigration
O
C) each allele must be equally beneficial
O
D) There must be a high mutation rate
I think the answer is B. Immigration must outpace emigration. Hope this helps!
Hardy-Weinberg equilibrium is the principle of the genetic variation being constant. Each allele must be equally beneficial for a population to be in equilibrium. Thus, option C is correct.
What is the requirement of Hardy-Weinberg equilibrium?
Hardy-Weinberg equilibrium states the invariant nature of genetic variation when there are no disturbing factors in a population. For an equilibrium condition, the population should have a large size. Each allele must be equally beneficial so that there is no genetic drift.
There should be no immigration or emigration of the organism in a particular population as it affects the generation and individuals. Also, there must be no spontaneous mutations for the variation to occur.
Therefore, each allele must be equally beneficial for equilibrium.
Learn more about Hardy-Weinberg equilibrium here:
https://brainly.com/question/16823644
#SPJ5
what is a cell that is the source of other cells
Answer:
stem cells
Explanation:
If a male organism has 40 chromosomes in each body cell, how many chromosomes does a female of the same sex have in each of her body cells?
Answer:
40
Explanation:
they're usually the same
What is a significant benefit of studying fossils?
How does evolution result in reproductive success?
Answer:
Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.
A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False
Answer:
Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.
Answer:
False
Explanation:
all you need is in the photo
Answer:
Aerobic means 'with air' and refers to the body producing energy with the use of oxygen. This typically involves any exercise that lasts longer than two minutes in duration. ... Anaerobic means 'without air' and refers to the body producing energy without oxygen.
Explanation:
hope this helps if not i'll try to figure out the answer for you
Compare the planets Mars and Saturn. Describe how their common characteristics are similar.
Answer:
Both Mars and Saturn have rings.
when you breathe in air you bring oxygen into your lungs and blow out. A.Carbon dioxide B.oxygen C.carbon monoxide D.hydrogen
Answer:
Carbon dioxide
Answer:
Carbon Dioxide
Explanation:
the final phase of mitosis characterized by the separated chromosomes reaching the poles
of the cell. The nuclear membrane and nucleolus begins to reappear around each set of
chromosomes
Answer:
Telophase
Explanation:
Hydrogen ions are found in_____________
which hydroxide ions are found in_______
A. Acids and bases
B. Bases and acids
C. Acids and salts
D. Bases and salts
Answer:
A
Explanation:
found in acid and bases
Florida's land ecosystems include___________________. Check ALL that apply. *
prairies
forests
beaches
dunes
estuaries
Answer:
dunes, beaches, and maybe estuaries
Explanation:
i hope thats right.....
why do atoms of the same element always have the same number of protons but sometimes have different mass number? What do you call these atoms?
Answer:
However, some helium atoms have more or less than two neutrons. Atoms with the same number of protons but different numbers of neutrons are called isotopes. Because the number of neutrons can vary for a given element, the mass numbers of different atoms of an element may also vary.
A plant is placed near a window. Instead of growing straight up, the plant grows to the side. What is this plant demonstrating? (1 point)
A)phototropism
B)dormancy
C)thigmotropism
D)gravitropism
A plant is placed near a window. Instead of growing straight up, the plant grows to the side. This plant demonstrates phototropism. Therefore, option A is correct.
What is phototropism?A plant can maximize photosynthetic light absorption in the aerial portion and water and nutrient uptake in the roots by using phototropism, or the differential cell elongation displayed by a plant organ in response to directed blue light.
Auxin is a hormone found at the ends of leaves and stems that reacts to light. It enables the plant to grow in a way that is favourable to the light source.
When a plant is placed near a window. Instead of growing straight up, the plant grows to the side. Then, this plant demonstrates phototropism. Therefore, option A is correct.
Learn more about phototropism, here:
https://brainly.com/question/24567669
#SPJ2
Researchers have found that mitochondria and chloroplasts in eukaryotic cells have their own DNA. This DNA is different from the DNA in a eukaryotic cell's nucleus. Chloroplasts and mitochondria use their own DNA and ribosomes to make some organelle-specific proteins.
What statement is best supported by this information?
A.
Modern cells could exist without mitochondria and chloroplasts.
B.
Early prokaryotic cells engulfed eukaryotic cells, which later became mitochondria and chloroplasts.
C.
Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.
D.
Mitochondria and chloroplasts could exist outside of modern cells.
Answer:
B.
Explanation:
Answer: Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.
Explanation: just did the test its right.
please answer this for me
Answer:
Im pretty sure its A the phagocytes.
Explanation:
PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.
Answer:
No, not according to any sciences (unless you mean aliens as in immigrants)
Explanation:
There is no way that we are the only living thing in the entire world. There has to be another species out there. They might be wondering if there is another living thing out in space too.
list one part of the cell theory in your own words, explain what it means
One part of the cell theory is that pre-existing cells can form more cells
This means that cells that currently exist are capable of creating more cells, however it’s a slow process
1. Would you consider a Zonkey (baby created from a donkey raised with a zebra) alive? Keep in mind that a Zonkey is sterile and cannot produce its own offspring.
2. Would you consider a virus alive? It requires a host completely to live.
Answer to 1:Yes the Zonkey is alive,not all organisms can reproduce. Some people are born with rare genetics were they can't give birth,so even if the Zonkey is sterile and can't produces it own offspring it is alive.
Answer to 2:Yes a virus is alive,it attacks the host and contains/kill other cells in your body. They also can multiple. If they can multiply and even attack and kill other cells they are alive.
20 points and brainliest! Explain how you got the answer!
Answer:
No of groups studied
As All other factors will effect the result ofvthe experiment.
But no matter how many groups you take to study they will show the same result
HOPE YOU GOT IT!
MARK ME AS BRAINIEST
(Uhm help?) The law of conservation of energy states that when there is an energy transfer or transformation, energy is lost.
Assuming this is a true/false question, the answer would be false.
According to the law of conservation of energy, energy is neither created nor destroyed; it simply changes forms.
Unless you are saying that some energy would be lost as heat, This is true.
Answer:
ae you trying to find the meaning?
Explanation:
The law of conservation of energy states that energy can neither be created nor destroyed - only converted from one form of energy to another. This means that a system always has the same amount of energy, unless it's added from the outside. The only way to use energy is to transform energy from one form to another.
ex: the cue ball is shot at a stationary 8 ball. The cue ball has energy. When the cue ball hits the 8 ball, the energy transfers from the cue ball to the 8 ball, sending the 8 ball into motion. The cue ball loses energy because the energy it had has been transferred to the 8 ball, so the cue ball slows down.
Can someone help me with the question please.
Answer:
B Sun > Algae > Shrimp > Red drum
HELP ASAP
A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period. Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October. People born in October were more relaxed and could better handle stress. Is the scientist’s research considered science?
Yes, because the scientist conducted his research for an extended period of time.
Yes, because the scientist followed the scientific method.
No, because the scientist conducted his research with 100 people
No, because the scientist followed personalities which is pseudoscience.
Answer:
No, because the scientist followed personalities which is pseudoscience.
Explanation:
A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period
Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October.
People born in October were more relaxed and could better handle stress
Is the scientist’s research considered science?
No, this are beliefs not necesarily true.
Answer 15 and 16 correctly and I will mark as brainliest
Answer:
I think its A and G
Answer:
15. B.
16. H
Explanation:
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
WILL MARK BRAINLIEST!!!!Which of the following processes express the information encoded by DNA
and RNA?
A. Transcription and translation
O B. Asexual and sexual reproduction
C. Photosynthesis and respiration
D. Mitosis and meiosis
Answer:
C
Explanation:
Thats the tea
Hope this helps ;)
The process that expresses the information encoded by DNA and RNA is Transcription and translation, so option A is correct. Transcription is the process by which the genetic information stored in DNA is transcribed into RNA.
Transcription is the process by which the genetic information stored in DNA is transcribed into RNA. It involves the synthesis of an RNA molecule using one strand of DNA as a template. The resulting RNA molecule, known as messenger RNA (mRNA), carries the genetic information from the DNA to the site of protein synthesis. Translation, on the other hand, is the process by which the information encoded in mRNA is used to synthesize a specific protein. It takes place in ribosomes, where transfer RNA (tRNA) molecules interpret the genetic code on the mRNA and bring the corresponding amino acids to assemble the protein chain.
Learn more about transcription and translation here.
https://brainly.com/question/29979094
#SPJ2
Searches related to what are some of the factors foresters have to consider before making decisions? help meeeee
forest fires,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
Which other food items were digested by lactase, the enzyme that breaks down milk?
Answer:
im not sure what you mean by this question but ill answer the best way i can!
Explanation:
Bread and baked goodsMilk chocolate and some candiesSalad dressings and saucesBreakfast cereals and cereal barsInstant potatoes, soups, rice and noodle mixesLunch meats (other than kosher)Cheese flavored crackers and other snacksthese are foods containing lactose in them, which lactase breaks down.
hope this helps!
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
please help with this question
Answer:
C
Explanation:
the answer is C bc I read this and u can site it in the text