In which one of the following solutions will acetic acid have the lowest percent ionization? There's a question on a practice exam similar to this. a) 0.1 M CH3COOH. b) 0.1 M CH3COOH dissolved in 0.2 M NH3. c) 0.1 M CH3COOH dissolved in 0.1 M HCI.

Answers

Answer 1

The correct answer is option C.0.1 M CH3COOH dissolved in 0.1 M HCl has the lowest percent ionization of acetic acid.

The percent ionization of acetic acid can be represented as:α = [H+] [CH3COO-] / [CH3COOH]Given three different solutions:a) 0.1 M CH3COOH.b) 0.1 M CH3COOH dissolved in 0.2 M NH3.c) 0.1 M CH3COOH dissolved in 0.1 M HCl.To calculate the percent ionization of acetic acid, we first need to calculate the equilibrium concentration of [H+] ion.Based on the given solutions, we can assume that the concentration of [H+] ion will be highest in solution (c) because of the presence of strong acid HCl which will completely dissociate into its ions and increases the concentration of [H+] ion. This makes the percent ionization of acetic acid the lowest in solution (c).Therefore, the correct answer is option C.0.1 M CH3COOH dissolved in 0.1 M HCl has the lowest percent ionization of acetic acid.

Learn more about ionization here,

https://brainly.com/question/20658080

#SPJ11


Related Questions

The atomic mass of 5626Fe is 55.934939 u, and the atomic mass of 5627Co is 55.939847 u.
1. 5627Co decays into 5626Fe
2. Beta+ (positron) decay
3. How much kinetic energy will the products of the decay have?

Answers

To calculate the kinetic energy of the products of the decay, we need to determine the energy released in the decay process.

In beta+ (positron) decay, a proton within the nucleus is converted into a neutron, and a positron and a neutrino are emitted. This process can be represented as follows:

5627Co -> 5626Fe + e+ + ν

The energy released in the decay is equal to the difference in the mass of the initial nucleus (5627Co) and the sum of the masses of the final nucleus (5626Fe), positron (e+), and neutrino (ν).

Let's calculate the energy released:

Mass of 5627Co = 55.939847 u

Mass of 5626Fe = 55.934939 u

Energy released = (Mass of 5627Co - Mass of 5626Fe) * c^2

where c is the speed of light in a vacuum, approximately 299,792,458 meters per second.

Energy released = (55.939847 u - 55.934939 u) * (299,792,458 m/s)^2

Kinetic energy = Energy released - Rest mass energy of the positron

The rest mass energy of the positron can be calculated using Einstein's mass-energy equivalence equation:

E = m * c^2

where E is the energy, m is the mass, and c is the speed of light.

Rest mass energy of the positron = (Mass of positron) * c^2

The rest mass of the positron is the same as that of an electron, which is approximately 9.10938356 × 10^-31 kilograms.

Rest mass energy of the positron = (9.10938356 × 10^-31 kg) * (299,792,458 m/s)^2

Finally, we can calculate the kinetic energy:

Kinetic energy = Energy released - Rest mass energy of the positron

Please note that the calculated values will be extremely small because positron decay involves a tiny mass difference.

Learn more about  kinetic energy here : brainly.com/question/999862
#SPJ11

a sample of gas occupies a volume of 69.5 ml . as it expands, it does 125.7 j of work on its surroundings at a constant pressure of 783 torr . what is the final volume of the gas?

Answers

The final volume of the gas is approximately 122.18 mL.

To find the final volume of the gas, we can use the formula for work done by a gas at constant pressure:

Work = Pressure(Change in Volume)

Given:

Initial Volume (V₁) = 69.5 mL

Work done (W) = 125.7 J

Pressure (P) = 783 torr

We need to convert the initial volume from milliliters (mL) to liters (L) to maintain consistent units:

V₁ = 69.5 mL = 69.5/1000 L = 0.0695 L

Now we can rearrange the formula to solve for the final volume (V₂):

W = P (V₂ - V₁)

Substituting the given values:

125.7 J = 783 torr (V₂ - 0.0695 L)

To maintain consistent units, we convert torr to atmospheres (atm):

1 atm = 760 torr

783 torr = 783/760 atm = 1.03 atm

125.7 J = 1.03 atm (V₂ - 0.0695 L)

Now we can solve for V₂:

125.7 J = 1.03 atm (V₂ - 1.03 atm * 0.0695 L)

⇒ (125.7 J + 1.03 atm) 0.0695 L = 1.03 atm * Vf

⇒ 125.7 J + 0.0713 atm L = 1.03 atm * Vf

⇒ V₂ = (125.7 J + 0.0713 atm L) / 1.03 atm

So, V₂ ≈ 122.18 mL (rounded to two decimal places)

Learn more about pressure-volume work here:

https://brainly.com/question/28573314

#SPJ4

#6. Which of the following identifies the element(s) as being oxidized and reduced in the reaction? 2 H2O2(aq) → 2 H2O(1)+ O2(g) O Hydrogen is oxidized and oxygen is reduced. O Oxygen is oxidized and hydrogen is reduced. O Oxygen is both oxidized and reduced. O No elements are oxidized or reduced the reaction is not a redox reaction.

Answers

The statement " Oxygen is oxidized and hydrogen is reduced" identifies the element(s) as being oxidized and reduced in the reaction.

What is oxidation?

Oxidation represents a chemical transformation entailing the relinquishment of electrons. Within an oxidation reaction, a certain entity forfeits electrons to another entity. The entity undergoing electron deprivation is referred to as oxidized, while the entity acquiring electrons is labeled as reduced.

Oxidation possesses the potential to be advantageous, serving purposes such as energy generation or the decomposition of detrimental substances. Nevertheless, oxidation may also manifest as a deleterious phenomenon, provoking the corrosion of metals or the decay of edibles.

Learn about oxidation and reduction here https://brainly.com/question/13182308

#SPJ4

Which is the best oxidizing agent in the following set?
You may use the table of standard cell potentials found on the data sheet.
Fe3+
Fe2+
Cu2+
Al3+
H+

Answers

The best oxidizing agent in the following set is Fe3+.

Iron (III) ion (Fe3+) is the best oxidizing agent in the set because its reduction potential (+0.77 V) is the highest. This means that Fe3+ can easily gain electrons to be reduced, and it can easily lose electrons to be oxidized. When a species readily gains electrons, it is a good oxidizing agent because it promotes oxidation in the other species; when a species readily loses electrons, it is a good reducing agent because it promotes reduction in the other species.According to the table of standard cell potentials, the potential of Fe3+ is highest at +0.77 V. So, Fe3+ is the best oxidizing agent among the given species.Fe3+ has the highest ability to gain electrons and reduce other species as compared to the other species in the set.

Learn more about oxidizing agent here:

https://brainly.com/question/29137128

#SPJ11

Consider this reaction: KOH + HBr ➝ KBr + H₂O


Which is the acid in this reaction?


A. KOH

B. HBr

C. KBr

D. H₂O

Answers

The acid in the given reaction is HBr (Option B). In a chemical reaction, acid is a substance that donates or gives away hydrogen ions (H+) while the base is a substance that accepts hydrogen ions.

When the base accepts the hydrogen ion, it becomes positively charged.What is the reaction given?Consider this reaction :KOH + HBr ➝ KBr + H₂OKOH is a base while HBr is an acid. When KOH and HBr react, they form KBr and H₂O (water). HBr loses a hydrogen ion to KOH which accepts it. Thus HBr donates a proton (H+) to KOH which accepts the proton. Therefore, HBr acts as an acid while KOH acts as a base. So, the correct answer is option B, HBr.Further HBr stands for hydrogen bromide, which is a highly acidic compound. It gives off H+ ions when dissolved in water and donates H+ ions to a base to produce water.

The given reaction is an example of a neutralization reaction, as a base KOH (potassium hydroxide) reacts with an acid, HBr (hydrogen bromide), to produce a salt, KBr (potassium bromide), and water.

To know more about chemical reaction visit:-

https://brainly.com/question/22817140

#SPJ11

The concentration of iodide ions in a saturated solution of lead(II) iodide is __________ M. The solubility product constantof PbI2 is 1.4x10-8
a. 3.8 x 10-4
b. 3.0 x 10-3
c. 1.5 x 10-3
d. 3.5 x 10-9
e. 1.4 x10-8

Answers

The concentration of iodide ions in a saturated solution of lead(II) iodide is approximately 3.5x10^-3 M. Option B

To determine the concentration of iodide ions in a saturated solution of lead(II) iodide, we need to use the solubility product constant (Ksp) of PbI2. The balanced equation for the dissolution of PbI2 is:

PbI2(s) ⇌ Pb2+(aq) + 2I-(aq)

The Ksp expression for this equation is:

Ksp = [Pb2+][I-]²

Given that the solubility product constant (Ksp) of PbI2 is 1.4x10^-8, we can assume that at equilibrium, the concentration of Pb2+ ions is equal to the concentration of iodide ions ([Pb2+] = [I-]). Let's denote the concentration of iodide ions as x.

Therefore, the Ksp expression becomes:

Ksp = x(x)² = x³

Substituting the value of Ksp into the equation:

1.4x10^-8 = x³

Taking the cube root of both sides:

x = (1.4x10^-8)^(1/3)

x ≈ 3.5x10^-3

Therefore, the concentration of iodide ions in a saturated solution of lead(II) iodide is approximately 3.5x10^-3 M. Option B

For more such  questions on concentration visit:

https://brainly.com/question/28564792

#SPJ8

The pressure of the H2 gas is increased in the cathode compartment.
The emf of the cell will increase.
The emf of the cell will decrease.

Answers

The effect of increasing the pressure of H2 gas in the cathode compartment on the electromotive force (emf) of the cell depends on the type of cell being considered.

In a hydrogen fuel cell, where hydrogen is oxidized at the anode and combined with oxygen at the cathode to produce water, increasing the pressure of H2 gas in the cathode compartment will have no direct effect on the emf of the cell. The emf of a hydrogen fuel cell is primarily determined by the redox reactions occurring at the anode and cathode, as well as the electrochemical potentials of those reactions. Therefore, increasing the pressure of H2 gas in the cathode compartment will not cause a change in the emf of the cell. On the other hand, if we consider a concentration cell, where the emf is based on the difference in concentration between the anode and cathode compartments, increasing the pressure of H2 gas in the cathode compartment would result in an increase in the emf of the cell. This is because the increased pressure would cause a higher concentration of H2 gas in the cathode compartment, leading to a greater concentration gradient between the anode and cathode compartments and thus an increased emf.

Learn more about pressure here : brainly.com/question/30673967
#SPJ11

identify the predominant intermolecular forces in each of the given substances.
Electrostatic (ionic) interactions : Hydrogen bonding :
van der Waals interactions :
options :
CaCl2
H2O NH4
CH4
NH3

Answers

the predominant forces in each of the following compounds are as follows: CaCl₂: ionic forces, H₂O: hydrogen bonding, NH₄: van der waals interaction, CH₄: vander waals interaction, NH₃: hydrogen bonding. these forces are based on the type of molecule or compound.

calcium chloride is an ionic compound and hence the interaction between its molecules is ionic. the bond formed between calcium chloride is formed by donation an acceptance of electron pair i.e ionic bond formation which is a strong bond.

water and NH₃ are polar molecules and also show hydrogen bonding between its molecules. oxygen forms hydrogen bond with hydrogen of another water molecule whereas nitrogen forms hydrogen bond with H of another NH₃ molecule. CH₄ and NH₄ are neutral molecules and hence have van der waals interaction.

to know more about hydrogen bonding refer to the link below

https://brainly.com/question/24317372

#SPJ4

Refrigerant-134a enters the compressor of a refrigerator as superheated vapor at 0.14 MPa and -10^oC at a rate of 0.121 kg/s, and it leaves at 0.7 MPa and 50^oC. The refrigerant is cooled in the condenser to 24^oC and 0.65 MPa, and it is throttled to 0.15 MPa. Disregard any heat transfer and pressure drops in the connecting lines. Determine
a) The rate of heat removal from the refrigerated space and the power input to the compressor,

Answers

Answer: Rate of heat removal = 22.07 kW and Power input to compressor = 12.38 kW

Explanation :

Given data: The mass flow rate of refrigerant, m = 0.121 kg/sThe initial state of refrigerant:Pressure, P1 = 0.14 MPaTemperature, T1 = -10°CThe final state of refrigerant:Pressure, P2 = 0.7 MPaTemperature, T2 = 50°CThe refrigerant is cooled to 24°C in the condenser and throttled to 0.15 MPa. The pressure at the exit of the throttling valve is P3 = 0.15 MPa.The refrigerant enters the evaporator as a saturated vapor at 0.15 MPa.

Let's start the calculations:Step 1: Determine the enthalpy of the refrigerant at the inlet and outlet states using the refrigerant table.At the inlet state, h1 = 251.43 kJ/kgAt the outlet state, h2 = 352.94 kJ/kgStep 2: Calculate the heat absorbed by the refrigerant during the cooling process.Q1 = m(h2 - h1) = 0.121(352.94 - 251.43) = 12.38 kWStep 3: Determine the enthalpy of the refrigerant at state 3 using the refrigerant table.h3 = 272.92 kJ/kgStep 4: Calculate the heat released by the refrigerant during the throttling process.Q2 = m(h2 - h3) = 0.121(352.94 - 272.92) = 9.69 kWStep 5: Calculate the rate of heat removal from the refrigerated space.Qout = Q1 + Q2 = 12.38 + 9.69 = 22.07 kWStep 6: Calculate the power input to the compressor.Wc = m(h2 - h1) = 0.121(352.94 - 251.43) = 12.38 kWTherefore, the rate of heat removal from the refrigerated space and the power input to the compressor are 22.07 kW and 12.38 kW, respectively.

Learn more about compressor of a refrigerator here https://brainly.in/question/55772143

#SPJ11

Complete and balance the following half-reaction in acidic solution TiO2 (s) — Ti?- (aq) 4. 03-02-0 O O2 O3+ 4+ 1 1 2. 3 4. 5 6 7 8 9 0 0 02 1. O 16 I 0, 0. + (s) (0) (g) (aq) e- о H H OH H30- H2O Ti

Answers

The balanced half-reaction in an acidic solution is TiO₂ (s) + 4H⁺ + 2H₂O + 4e⁻ → Ti²⁺.

To complete and balance the half-reaction:

TiO₂ (s) → Ti²⁺

First, we need to balance the oxygen atoms. Since the solid TiO₂ contains two oxygen atoms, we add two water molecules (H₂O) to the product side:

TiO₂ (s) + 2H₂O → Ti²⁺

Next, we balance the hydrogen atoms by adding four hydrogen ions (H⁺) to the reactant side:

TiO₂ (s) + 4H⁺ + 2H₂O → Ti²⁺

Finally, we balance the charges by adding four electrons (e⁻) to the reactant side:

TiO₂ (s) + 4H⁺ + 2H₂O + 4e⁻ → Ti²⁺

This is the balanced chemical equation.

Learn more about balanced chemical equation visit:

https://brainly.com/question/28294176

#SPJ4

from a consideration of the masses of water measured in part c, and given that the density of water is 1 glml, which is the most ac€urate method of volume measurement--cylinder, pipet, or buret

Answers

The most accurate method of volume measurement among a cylinder, pipet, and buret can be determined by considering the masses of water measured.

To determine the most accurate method of volume measurement, we need to compare the measured masses of water using the different instruments and consider the density of water, which is 1 g/mL.

The density of water tells us that 1 mL of water has a mass of 1 gram. If the measured masses of water using the instruments are close to the expected values based on the density of water, it suggests that the instrument provides accurate volume measurements.

For example, if the measured mass of water using the cylinder is very close to the expected mass based on the volume calculated using the density of water, then the cylinder can be considered an accurate method of volume measurement. Similarly, if the measured masses using the pipet or buret are close to the expected values, then those instruments can be considered accurate as well.

Learn more about density here:

https://brainly.com/question/29775886

#SPJ11

Synthesizing and analyzing a coordination compound of Nickel (II) ion, Ammonia, and chloride ion experiment

Answers

Synthesizing and analyzing a coordination compound of Nickel (II) ion, Ammonia, and chloride ion can be an interesting experiment to explore the formation and properties of coordination complexes.

Here is a general procedure for conducting such an experiment:

Materials and reagents:

Nickel (II) chloride hexahydrate (NiCl2·6H2O)Ammonium hydroxide (NH4OH)Hydrochloric acid (HCl)Distilled waterSolvent and glassware (beakers, test tubes, pipettes, etc.)Analytical tools (balance, centrifuge, etc.)Safety equipment (gloves, goggles, etc.)

Preparation of the coordination compound:

Dissolve a known amount of Nickel (II) chloride hexahydrate in distilled water to obtain a desired concentration.Add drops of concentrated hydrochloric acid to the solution to adjust the pH.Slowly add ammonium hydroxide (NH4OH) dropwise to the solution while stirring until the precipitate formed initially dissolves. The solution should turn pale blue.

Isolation and purification:

Centrifuge the solution to separate the solid precipitate.Wash the precipitate with distilled water to remove any impurities.Repeat the centrifugation and washing process a few times.Dry the purified coordination compound, which may involve heating or vacuum drying.

Analysis of the coordination compound:

Perform elemental analysis to determine the composition of the compound.Use spectroscopic techniques (such as UV-Vis spectroscopy) to analyze the electronic transitions and absorption properties of the complex.Conduct X-ray crystallography, if possible, to determine the structure and bonding arrangement of the coordination compound.Perform other characterization techniques like IR spectroscopy, mass spectrometry, or NMR spectroscopy to gain further insight into the compound's properties.

Data interpretation and conclusions:

Analyze the obtained data and compare it to the expected properties and characteristics of Nickel (II) ion coordinated with ammonia and chloride ion.Draw conclusions about the synthesis, properties, and structure of the coordination compound.Discuss any observed trends or deviations from expected results.

To know more about NMR spectroscopy

https://brainly.com/question/30583972

#SPJ11

Final answer:

In a coordination compound of Nickel (II) ion, Ammonia, and Chloride ion, Nickel (II) is the central metal ion, with ligands surrounding it. This is an example of an octahedral complex, and its study provides understanding of molecular geometry rules, coordination numbers, geometries and ligand field stabilizations.

Explanation:

To synthesize and analyze a coordination compound of Nickel (II) ion, Ammonia, and Chloride ion in an experiment, you need to understand the structure and reactivity of such compounds. Coordination compounds are formed when a central metal ion (in this case, Nickel (II)) forms bonds with surrounding species (ligands) which are either neutral or anions. In the case of [Ni(NH3)6]²+, Nickel (II) ion is the central metal ion, with 6 Ammonia molecules surrounding it as ligands. The compound [Ni(NH3)6]²+ is a classic example of an octahedral complex, where six ammonia molecules are arranged around the nickel ion in a shape resembling an octahedron.

Understanding such structures requires knowledge of molecular geometry rules, with specific attention to coordination number, geometries and resulting ligand field stabilizations. This synthesis experiment can provide hands-on experience with these essential chemistry concepts.

Learn more about Coordination Compound here:

https://brainly.com/question/37156286

#SPJ12

In one to two sentences, explain why metal is often used for making wire and the properties that make metal useful. text format please

Answers

Metals are often used for making wire because they have high electrical conductivity, allowing for efficient transmission of electricity, and they possess malleability and ductility.

What is electrical conductivity

Electrical conductivity refers to the ability of a material to conduct electric current. It is a measure of how easily electrons can flow through a substance when an electric potential difference (voltage) is applied across it.

Materials with high electrical conductivity allow electric charges to move freely  while materials with low electrical conductivity impede the flow of electric current.

Metals are known for their high electrical conductivity  which makes them excellent conductors of electricity.

Learn more about metal  at

https://brainly.com/question/4701542

#SPJ4

he heat of vaporization of benzene is . calculate the change in entropy when of benzene boils at . be sure your answer contains a unit symbol. round your answer to significant digits.

Answers

The change in entropy when benzene boils at 80.1 °C is 0.087 kJ/(mol·K).

Given data:

The heat of vaporization of benzene, ΔHvap = 30.8 kJ/mol

Boiling point of benzene, T = 80.1 °C = 353.25 K

The change in entropy (ΔS) when benzene boils can be calculated using the formula:

ΔS = ΔHvap / T

Substituting the given values, we get:

ΔS = (30.8 kJ/mol) / (353.25 K) = 0.0871 kJ/(mol·K)

Round off the answer to significant digits and include the unit symbol, we get:ΔS = 0.087 kJ/(mol·K)

Therefore, the change in entropy when benzene boils at 80.1 °C is 0.087 kJ/(mol·K).

Learn more about change in entropy  here:

https://brainly.com/question/28244712

#SPJ11

only 0.015 l of a 0.880 m barium nitrate solution is available to mix with 0.024 l sample of a 1.36 m potassium sulfate solution. the precipitate baso4 is centrifuged, collected, dried, and found to have a mass of 2.52 g . what are the theoretical yield, and the percent yield. (answer: 3.08 g, 81.8%)

Answers

Only 0.015 l of a 0.880 m barium nitrate solution and 0.024 l of a 1.36 m potassium sulfate sample are available for mixing. The precipitate  BaSO₄ has a mass of 2.52 g after being centrifuged, collected, and dried. The percent yield is about 81.8%, and the theoretical yield is 3.08 g.

To calculate the theoretical yield and percent yield, we first need to determine the limiting reactant. The limiting reactant is the one that is completely consumed and determines the maximum amount of product that can be formed.

Let's calculate the moles of barium nitrate (Ba(NO₃)₂) and potassium sulfate (K₂SO₄) using their respective concentrations and volumes:

Moles of Ba(NO₃)₂ = 0.015 L × 0.880 mol/L = 0.0132 mol

Moles of K₂SO₄ = 0.024 L × 1.36 mol/L = 0.03264 mol

Now, we can compare the moles of the two reactants to determine the limiting reactant.

Ba(NO₃)₂:K₂SO₄ ratio = 0.0132 mol : 0.03264 mol ≈ 1 : 2.47

Since the ratio is approximately 1:2.47, it means that Ba(NO₃)₂ is the limiting reactant. Therefore, the amount of BaSO₄ formed will be determined by the moles of Ba(NO₃)₂.

To calculate the theoretical yield of BaSO₄, we need to convert the moles of Ba(NO₃)₂ to grams of BaSO₄ using the molar mass:

Molar mass of BaSO₄ = 137.33 g/mol (from periodic table)

Theoretical yield of BaSO₄ = 0.0132 mol × 233.39 g/mol = 3.08 g

Now, we can calculate the percent yield by dividing the actual yield (2.52 g) by the theoretical yield (3.08 g) and multiplying by 100:

[tex]\begin{equation}\text{Percent yield} = \frac{2.52 \text{ g}}{3.08 \text{ g}} \times 100\% \approx 81.8\%[/tex]

Therefore, the theoretical yield is 3.08 g and the percent yield is approximately 81.8%.

To know more about the limiting reactant refer here :

https://brainly.com/question/32459503#

#SPJ11

How does the periodic table organize atoms of elements with the same number of valence electrons?
a.in cells
b.in columns
c.in diagonals
d.inn rows

Answers

The periodic table organizes atoms of elements with the same number of valence electrons in columns, i.e., option b. As a result, the number of valence electrons increases from left to right across a period. Thus, we can conclude that the periodic table organizes atoms of elements with the same number of valence electrons in columns.

The periodic table is an arrangement of elements according to their atomic number. Elements in the periodic table are arranged in order of increasing atomic number, and elements with similar chemical and physical properties are arranged in columns called groups or families.The periodic table is arranged such that elements with similar chemical and physical properties are in the same group. For example, elements in group 1 all have one valence electron, while elements in group 2 have two valence electrons.Elements in the same group have the same number of valence electrons, which is the number of electrons in the outermost shell of an atom. Valence electrons are the outermost electrons, which are involved in chemical reactions, so elements with the same number of valence electrons have similar chemical properties. The number of valence electrons also determines the element's position in the periodic table.An element's valence electrons are responsible for its chemical properties, so elements with the same number of valence electrons have similar chemical properties. As a result, the periodic table arranges elements with the same number of valence electrons in the same group or column, making it easier to predict their chemical behavior. The periodic table is also arranged such that elements with the same number of energy levels are in the same row or period.Each period in the periodic table represents an energy level. The first period has only one energy level, while the second period has two, and so on. As a result, the number of valence electrons increases from left to right across a period. Thus, we can conclude that the periodic table organizes atoms of elements with the same number of valence electrons in columns.

To know more about valence electrons visit:

https://brainly.com/question/31264554

#SPJ11

AgCl(s) ⇌ Ag+(aq) + Cl-(aq)
What is happening to the entropy in the following reaction? If entropy changes, what is the sign of ΔS?
Answers: Increase; positive
Decrease; negative
Decrease; positive
Increase; negative

Answers

If entropy changes, the sign of ΔS is determined as Increase; positive.

option A.

What is entropy?

Entropy is the measure of a system's thermal energy per unit temperature that is unavailable for doing useful work.

Entropy can also be defined as the measure of the disorder of a system.

Mathematically, the formula for entropy of a system is given as;

ΔS = E/T

where;

E is the thermal energyT is the unit temperature

The given chemical reaction;

AgCl(s) ⇌ Ag⁺(aq) + Cl⁻(aq)

In the reaction given above, we can see that solid compound AgCl(s) is decomposed into two aqueous ions (Ag⁺(aq) + Cl⁻(aq)).

From solid to liquid, indicates increase in disorderliness, hence entropy increased.

Learn more about entropy here: https://brainly.com/question/6364271

#SPJ4

what mass of water should be added to 22.0 g of kcl to make a 5.50y mass solution? practice show your work.

Answers

To make a 5.50% mass solution of KCl, you should add 94.50 grams of water to 22.0 grams of KCl.

To determine the mass of water needed to make a 5.50% mass solution of KCl, we need to consider the following:

Mass percent = (mass of solute / mass of solution) x 100%

Given:

Mass percent = 5.50%

Mass of KCl = 22.0 g

Mass of solution = ?

Mass of water = ?

Let's assume the mass of the solution is 100 grams. Since the mass percent is given as 5.50%, we can calculate the mass of KCl in the solution:

Mass of KCl = (5.50 / 100) x 100 g = 5.50 g

The mass of water can be obtained by subtracting the mass of KCl from the total mass of the solution:

Mass of water = Mass of solution - Mass of KCl

Mass of water = 100 g - 5.50 g

Mass of water = 94.50 g

Therefore, to make a 5.50% mass solution of KCl, you should add 94.50 grams of water to 22.0 grams of KCl.

Learn more about Mass percent here:

https://brainly.com/question/5840377

#SPJ11

If a hydrogen atom has its electron in the n = 2 state, how much energy, in electronvolts, is needed to ionize it?

Answers

The energy required to ionize the hydrogen atom is 10.2 electron volts. The ionization energy of hydrogen is a critical concept in atomic physics and is used to explain various atomic phenomena, including atomic spectra.

When an electron is removed from a hydrogen atom, ionization occurs. The energy required to remove the electron from the hydrogen atom is known as ionization energy. In the case of hydrogen, ionization energy is the energy required to remove the electron from the hydrogen atom's electron shell, resulting in the production of a hydrogen ion.

The ionization energy can be calculated using the Rydberg formula. The energy of a hydrogen atom is given by the equation:  E = -13.6 / n2, where n is the principal quantum number of the electron, and the negative sign indicates that the energy is bound. When an electron transitions from the ground state to an excited state, energy is absorbed, and when an electron transitions from an excited state to the ground state, energy is emitted. In the present case, the electron is in the n = 2 state.

To ionize the hydrogen atom, the energy required is 13.6 / 22 - 13.6 / 1 2 = 10.2 eV. Therefore, the energy required to ionize the hydrogen atom is 10.2 electron volts.  

know more about hydrogen atom,

https://brainly.com/question/30886690

#SPJ11

if 35.22 ml of naoh solution completely neutralizes a solution containing 0.544 g of khp, what is the molarity of the naoh solution?

Answers

The molarity of the NaOH solution is 0.0754 M. Answer: 0.0754 M.

Molarity can be defined as the number of moles of solute present in per liter of solution. To calculate the molarity of the NaOH solution, we need to use the given information. Given that 35.22 mL of NaOH solution completely neutralizes a solution containing 0.544 g of KHP.We can use the formula for molarity:

Molarity = (mass of solute / molar mass of solute) / volume of solution in L

First, we need to calculate the number of moles of KHP.Number of moles of KHP = mass of KHP / molar mass of KHP

Number of moles of KHP = 0.544 / 204.22 = 0.00266 mol

Now, we can use the balanced chemical equation for the reaction between NaOH and KHP:

NaOH + KHC8H4O4 → KNaC8H4O4 + H2O

From the equation, we can see that one mole of NaOH reacts with one mole of KHP. Therefore, the number of moles of NaOH used in the reaction is also 0.00266 mol.Since the volume of the NaOH solution used is 35.22 mL, we need to convert it into liters.Volume of NaOH solution used = 35.22 mL = 0.03522 L

Now we can calculate the molarity of the NaOH solution:

Molarity = number of moles / volume of solution

Molarity = 0.00266 / 0.03522

Molarity = 0.0754 M

Therefore, the molarity of the NaOH solution is 0.0754 M. Answer: 0.0754 M.

To know more about molarity visit:

https://brainly.com/question/31545539

#SPJ11

What is the heat of vaporization of a substance if 10,776 cal are required to vaporize 5.05 g? Express your final answer in joules per gram.

Answers

The heat of vaporization of the substance is approximately 8,922.982 joules per gram.

To calculate the heat of vaporization (ΔHvap) of a substance, we need to use the formula:

ΔHvap = q / m

where q is the heat energy required for vaporization and m is the mass of the substance.

Given that 10,776 cal (calories) are required to vaporize 5.05 g, we first need to convert the heat energy from calories to joules since the final answer should be in joules per gram.

1 cal = 4.184 J

So, 10,776 cal = 10,776 * 4.184 J = 45,043.184 J

Now we can calculate the heat of vaporization:

ΔHvap = 45,043.184 J / 5.05 g

ΔHvap ≈ 8,922.982 J/g

Therefore, the heat of vaporization of the substance is approximately 8,922.982 joules per gram.

Learn more about heat of vaporization here:

https://brainly.com/question/29210982

#SPJ11

Ammonia NH3 gas and oxygen O2 gas react to form nitrogen N2 gas and water H2O vapor. Suppose you have 5.0 mol of NH3 and 11.0 mol of O2 in a reactor. What would be the limiting reactant? Enter its chemical formula below.

Answers

NH3 is the limiting reactant.

To find out the limiting reactant between 5.0 mol of NH3 and 11.0 mol of O2 in a reactor when they react to produce nitrogen and water vapor, you can start by writing a balanced equation for the reaction:

4NH3(g) + 3O2(g) → 2N2(g) + 6H2O(g)

The balanced equation shows that four moles of NH3 reacts with three moles of O2 to form two moles of N2 and six moles of H2O.

Therefore, the stoichiometric ratio of NH3 to O2 is 4:3.

If we have 5.0 moles of NH3, we can calculate the number of moles of O2 required for complete reaction as follows:

5.0 mol NH3 × (3 mol O2 / 4 mol NH3) = 3.75 mol O2

This shows that 3.75 mol of O2 is required to react completely with 5.0 mol of NH3. Since we have 11.0 mol of O2 available and this is more than the required amount of 3.75 mol, O2 is not the limiting reactant.

However, if we consider 5.0 mol of NH3, this will require 3.75 moles of O2, which is not available. This means that NH3 is the limiting reactant.The chemical formula of the limiting reactant is NH3.

Learn more about limiting reactant here:

https://brainly.com/question/10090573

#SPJ11

Calculate the weight of KCLO3 that would be required to produce 29.5 L of oxygen measured at 127 degrees Celsius and 760 torr.
Oxygen:
Oxygen may refer to different things: the element itself and/or the gas molecule. The element is represented with the chemical symbol of "O." Moreover, the oxygen gas molecule is a diatomic substance represented as
.

Answers

The required weight of KCLO3 would be 83.3 grams which was obtained by multiplying the number of moles of KCLO3 with the molar mass of KCLO3 which was calculated as 122.55 g/mol.

Given volume of O2 produced (V) = 29.5 LOxygen gas is diatomic; thus, its molecular formula is O2. From this, it follows that one mole of O2 has a volume of 22.4 L when measured at standard temperature and pressure (STP). At STP, the temperature is 273.15 K and the pressure is 1 atm (or 760 torr).The volume of O2 produced can be converted to the number of moles of O2 using the relationship:PV = nRT Where P is the pressure, V is the volume, n is the number of moles, R is the gas constant, and T is the temperature in kelvin. Solving for n: n = PV/RT

Substituting the values: n = (760 torr) x (29.5 L) / [(0.0821 L atm mol^-1 K^-1) x (127 + 273.15) K]n = 1.02 molO2 is produced from the reaction:2 KCLO3(s) → 2 KCl(s) + 3 O2(g)The balanced chemical equation shows that three moles of O2 are produced from every two moles of KCLO3 used.Therefore, the number of moles of KCLO3 required to produce 1.02 mol of O2 is:2 mol KCLO3 : 3 mol O21 mol KCLO3 : 3/2 mol O21.02 mol O2 x (1 mol KCLO3 / (3/2 mol O2)) = 0.68 mol KCLO3The molar mass of KCLO3 is 122.55 g/mol.The weight of KCLO3 required to produce 29.5 L of oxygen measured at 127 degrees Celsius and 760 torr is:Weight = number of moles x molar massWeight = 0.68 mol x 122.55 g/mol = 83.3 gTherefore, the weight of KCLO3 that would be required to produce 29.5 L of oxygen measured at 127 degrees Celsius and 760 torr is 83.3 g.Explanation:Thus, the required weight of KCLO3 would be 83.3 grams which was obtained by multiplying the number of moles of KCLO3 with the molar mass of KCLO3 which was calculated as 122.55 g/mol.

Learn more about chemical equation here,

https://brainly.com/question/26694427

#SPJ11

You have a sample of sulfuric acid with an unknown concentration and you perform a titration with sodium hydroxide to determine the concentration.Your titration data for one trial is below:
Initial burette reading (cm3)
10.20
Final burette reading (cm3)
20.55
The volume of acid used in each titration is 10.00 cm3 and the concentration of NaOH used is 0.1000 mol dm−3.
Determine the concentration of the sulfuric acid in mol dm−3. Round your answer to four significant figures

Answers

The concentration of sulfuric acid is approximately 5.000 × 10⁻³ mol/dm³.

To determine the concentration of sulfuric acid, we can use the concept of stoichiometry and the volume and concentration data from the titration.

The balanced chemical equation for the reaction between sulfuric acid (H₂SO₄) and sodium hydroxide (NaOH) is:

H₂SO₄ + 2NaOH -> Na₂SO₄ + 2H₂O

From the equation, we can see that one mole of sulfuric acid reacts with two moles of sodium hydroxide.

Given that the volume of sodium hydroxide used in the titration is 10.00 cm³ and its concentration is 0.1000 mol/dm³, we can calculate the number of moles of sodium hydroxide used:

moles of NaOH = volume × concentration = 10.00 cm³ × 0.1000 mol/dm³ = 1.0000 × 10⁻³ mol

Since the stoichiometric ratio between sulfuric acid and sodium hydroxide is 1:2, the number of moles of sulfuric acid is half of the moles of sodium hydroxide:

moles of H₂SO₄ = 1/2 × moles of NaOH = 1/2 × 1.0000 × 10⁻³ mol = 5.0000 × 10⁻⁴ mol

Now, we can calculate the concentration of sulfuric acid:

concentration of H₂SO₄ = moles/volume = 5.0000 × 10⁻⁴ mol / 10.00 cm³ = 5.0000 × 10⁻³ mol/dm³

Rounding to four significant figures, the concentration of sulfuric acid is approximately 5.000 × 10⁻³ mol/dm³.

Learn more about sulfuric acid from the link given below.

https://brainly.com/question/1107054

#SPJ4

consider the cell: ni(s) | ni2 (aq, ?m) || cu2 (aq, 0.136 m) | cu(s) ni2 (aq)/ni(s) e° = -0.257 v cu2 (aq)/cu(s) e° = 0.340 v the measured potential of the cell is 0.621 v. what is [ni2 ] at 25 °c?

Answers

The Nernst equation can be used to determine the concentration of a redox couple. The answer is 0.069 M.

The equation is: E = E° - (RT/nF) ln(Q)where E is the potential of the cell at any moment in time, E° is the standard potential, R is the ideal gas constant, T is temperature, n is the number of moles of electrons exchanged in the reaction, F is Faraday's constant, and Q is the reaction quotient. The reaction quotient for this half-cell is:[ni2+]/[Ni].  The Nernst equation can be rearranged to solve for [ni2+]:[ni2+] = [Ni] x e^(nE°/RT) x e^(-nFE/RT). We will solve for [ni2+] using the given data: E = 0.621 V, E° = -0.257 V, n = 2, F = 96485 C/mol, R = 8.31 J/(mol*K), and T = 298 K. First, let's find the difference between E and E°.∆E = E - E°∆E = 0.621 V - (-0.257 V)∆E = 0.878 V.

Now let's plug in the values:[ni2+] = [Ni] x e^(nE°/RT) x e^(-nFE/RT)[ni2+] = [Ni] x e^(nE°/RT) x e^(-∆E/RT)[ni2+] = [Ni] x e^(-2F∆E/RT). To solve for [ni2+], we need to determine the value of [Ni]. We can do this by using the concentration of Cu2+ and the measured potential of the cell. The overall reaction for this cell is:2Ni(s) + Cu2+(aq) -> 2Ni2+(aq) + Cu(s)The cell potential is the sum of the potential of the anode (ni(s) | ni2+(aq)) and the potential of the cathode (cu2+(aq) | cu(s)).Ecell = Eanode + Ecathode. Ecell = (-0.257 V) + (0.340 V). Ecell = 0.083 V.

Now we can use the Nernst equation to solve for [Ni]:0.083 V = E° - (RT/nF) ln(Q)[Ni]/[ni2+]^2 = e^(nFE°/RT) x e^(-E/RT)[Ni]/[ni2+]^2 = e^(2(-0.257)/0.025) x e^(-96485/8.31 x 298 x 0.083)[Ni]/[ni2+]^2 = 0.0037[Ni]/[Ni2+] = √0.0037[Ni2+] = [Ni]/√0.0037[Ni2+] = [ni2+] x √0.0037[Ni2+]. We can now substitute this expression into the previous equation:[ni2+] x √0.0037 = [Cu2+] x e^(2(-0.257)/0.025) x e^(-96485/8.31 x 298 x 0.083)[ni2+] = [Cu2+] x e^(2(0.257)/0.025) x e^(96485/8.31 x 298 x 0.083) / √0.0037[ni2+] = 0.069 M.

Thus, the answer is 0.069 M.

know more about Nernst equation,

https://brainly.com/question/13043546

#SPJ11

Describe what occurs at the molecular level when a mixture is sublimed. How does sublimation purify a substance? What materials are removed? Why do we not do melting point directly on camphor to assess its purity?

Answers

During sublimation, the thermal energy increases the kinetic energy of the particles, causing them to break intermolecular bonds and escape into the gas phase by selectively removing impurities that have different sublimation temperatures than the desired substance.

In the case of camphor, direct melting point determination is not suitable for purity assessment because camphor has a tendency to undergo decomposition rather than pure melting. Camphor can sublime at temperatures below its melting point, which means it can transition directly from a solid to a gas without melting into a liquid. This sublimation behaviour can lead to unreliable or misleading melting point measurements, making it an unsuitable method for assessing the purity of camphor. Instead, sublimation can be employed to purify camphor by selectively removing impurities that have different sublimation temperatures than camphor itself.

To learn more about sublimation, click here: brainly.com/question/29304516

#SPJ11

Calculate the enthalpy of the following reaction:
C (s) + 2 H2 (g) --> CH4 (g)
Given:
C (s) + O2 (g) --> CO2 ΔH = -393 kJ
H2 + 1/2O2 --> H2O. ΔH = -286 kJ
CH4 + 2O2 --> CO2 + 2H2O ΔH = -892 kJ

Answers

Enthalpy of the products = Enthalpy of CH4 = 0 kJ. Enthalpy of the reactants = Enthalpy of C (s) + 2 H2 (g) = -74 kJ∴ ΔH of the given reaction = Enthalpy of the products - Enthalpy of the reactants= 0 kJ - (-74 kJ)= 74 kJ. The enthalpy of the reaction is 74 kJ.

The enthalpy of the given reaction needs to be calculated. The enthalpy of a reaction is the amount of heat absorbed or released during the reaction. The enthalpy of a reaction is a thermodynamic quantity that is a measure of the energy of the chemical bonds broken and formed during the reaction.

The reaction given is C (s) + 2 H2 (g) --> CH4 (g)The enthalpy change for the first equation is given as:C (s) + O2 (g) --> CO2 ΔH = -393 kJ. The enthalpy change for the second equation is given as:H2 + 1/2O2 --> H2O. ΔH = -286 kJThe enthalpy change for the third equation is given as:CH4 + 2O2 --> CO2 + 2H2O ΔH = -892 kJ.

The enthalpy change for the reaction we want to find is the sum of the enthalpies of the three equations given above. To find the enthalpy change of the given reaction, the enthalpies of the first and second equations need to be multiplied by a factor of two as they are multiplied to form the given reaction.

C (s) + 2 O2 (g) → 2 CO2 (g); ΔH = -2 x 393 = -786 kJ2 H2 (g) + O2 (g) → 2 H2O (l); ΔH = -2 x 286 = -572 kJ.The enthalpy change of the given reaction can now be found by subtracting the enthalpy of the reactants from the enthalpy of the products. Enthalpy of the products = Enthalpy of CH4 = 0 kJ. Enthalpy of the reactants = Enthalpy of C (s) + 2 H2 (g) = -74 kJ∴ ΔH of the given reaction = Enthalpy of the products - Enthalpy of the reactants= 0 kJ - (-74 kJ)= 74 kJThe enthalpy of the reaction is 74 kJ.

To know more about Enthalpy refer here: https://brainly.com/question/29145818#

#SPJ11

Ammonia, NH3(g), and hydrogen chloride, HCl(g), react to form solid ammonium chloride, NH4Cl(s): NH3 (g) + HCl (g) → NH4Cl (8) Two 2.50 L flasks at 30.0°C are connected by a stopcock, as shown in the drawing
NH3(g)
HCl(g)
One flask contains 5.60gNH3(g), and the other contains 4.60 g HCl(g). When the stopcock is opened, the gases react until one is completely consumed. a) Which gas will remain in the system after the reaction is complete?
NH3NH3
HClHCl
b) What will be the final pressure of the system after the reaction is complete? (Neglect the volume of the ammonium chloride formed.
c) What mass of ammonium chloride will be formed?

Answers

The gas that will remain in the system after the reaction is complete is HCl. The final pressure of the system will be the same as the initial pressure after the reaction is complete. Approximately 6.74 g of ammonium chloride will be formed.

To determine which gas remains in the system after the reaction is complete, we need to compare the amounts of NH₃(g) and HCl(g) initially present in the flasks.

Given:

Mass of NH₃ = 5.60 g

Mass of HCl = 4.60 g

We can use the molar masses of NH₃ and HCl to convert the masses to moles:

Molar mass of NH₃ = 17.03 g/mol

Molar mass of HCl = 36.46 g/mol

Moles of NH₃ = 5.60 g / 17.03 g/mol ≈ 0.328 mol

Moles of HCl = 4.60 g / 36.46 g/mol ≈ 0.126 mol

The balanced equation for the reaction is:

NH₃(g) + HCl(g) → NH₄Cl(s)

According to the stoichiometry of the reaction, the ratio of NH₃ to HCl is 1:1. Since the moles of NH₃ and HCl are not in a 1:1 ratio, one of the reactants will be completely consumed while the other will be left over.

Since the moles of NH₃ are greater than the moles of HCl, NH₃ will be the limiting reactant, and HCl will be left over.

a) The gas that will remain in the system after the reaction is complete is HCl.

b) To determine the final pressure of the system after the reaction is complete, we need to consider the ideal gas law, which states:

PV = nRT

Since the volume (V), temperature (T), and gas constant (R) are constant, the product of pressure (P) and the number of moles (n) is constant.

Therefore, the final pressure of the system will be the same as the initial pressure, assuming no other factors (such as volume changes) affect the pressure.

c) To determine the mass of ammonium chloride formed, we need to consider the stoichiometry of the reaction. Since NH₃ and HCl react in a 1:1 ratio, the moles of NH₃ reacted will be equal to the moles of NH₄Cl formed.

Molar mass of NH₄Cl = 53.49 g/mol

Moles of NH₄Cl formed = Moles of NH₃ reacted = 0.126 mol

Mass of NH₄Cl formed = Moles of NH₄Cl formed × Molar mass of NH₄Cl

Mass of NH₄Cl formed = 0.126 mol × 53.49 g/mol ≈ 6.74 g

Therefore, approximately 6.74 g of ammonium chloride will be formed.

Learn more about molar mass here:

https://brainly.com/question/30640134

#SPJ4

2. In the synthesis of camphor, what compound would be a common impurity?
A. Water
B. Acetic Acid
C. Isoborneol
D. Sodium hypochlorite

Answers

In the synthesis of camphor, a common impurity is C. Isoborneol. Hence, option C is correct.

During the synthesis of camphor, starting from the precursor compound called borneol, one of the intermediate products formed is isoborneol. Isoborneol is structurally similar to camphor and can be produced as a byproduct or impurity during the synthesis process.

A. Water and B. Acetic Acid are commonly used reagents or solvents in the synthesis of camphor, but they are not typically considered as impurities in the final product.

D. Sodium hypochlorite is used as an oxidizing agent in the conversion of borneol to camphor but is not a common impurity in the final product.

Therefore, the correct answer is C. Isoborneol.

Learn more about Camphor from the link given below.

https://brainly.com/question/31843894

#SPJ4

triphenyl mehtane readily undergoes autooxidation to produce hydroperoxide.
a) draw the expected hydroperoxide.
b) explain why triphenylmethane is so susceptible to autooxidation.
c) in the presence of phenol( C6H5OH), triphenylmehtane undergoes autooxidation at much slower rate. explain this observation.

Answers

We can see here that:

a) The expected hydroperoxide formed from the autooxidation of triphenylmethane can be represented as follows: Ph-C-O-O-H

Here, "Ph" represents the phenyl group [tex]C_{6} H_{5}-[/tex]

What is autooxidation?

Autooxidation is a chemical reaction that occurs spontaneously when a substance comes into contact with atmospheric oxygen (O2) without the need for an external source of energy or a catalyst.

b) Triphenylmethane (Ph3CH) is susceptible to autooxidation due to the presence of electron-rich aromatic rings in its structure. The autooxidation process involves the transfer of oxygen atoms from atmospheric oxygen to the organic molecule, leading to the formation of reactive oxygen species.

c) The presence of phenol (C6H5OH) in the reaction mixture slows down the autooxidation of triphenylmethane. This can be attributed to the antioxidant properties of phenol. Phenol acts as a radical scavenger, meaning it can readily react with and neutralize free radicals that are formed during the autooxidation process.

Learn more about autooxidation on https://brainly.com/question/31813321

#SPJ4

Other Questions
Please help me Im timed Find the general solution of the nonhomogeneous differential equation, 2y""' + y" + 2y' + y = 2t2 + 3. Fill in each box below with an integer or a reduced fraction. (a) log 16: = 4 can be written in the form 24 = B where A = and B = (b) log, 125 = 3 can be written in the form 5C = D where C = and D= = Aman Private School is a new Integrated School just operating at Puncak Alam. Since the school is still new, the policy of the fee collection is only by cash payment. The process of fee payment for these 2 months is as follows: Miss Huda is an account clerk who will receive the cash fee payment made by the parents every day. She will issue the original receipt of payment to respective parents and cash collected is kept in the locked drawer near her place. The copy of the receipts then will be stored in the collection file. At the end of the school hours, she will count the cash and prepare the daily report that shows the fee details to ensure it is tally with the daily receipts issued. Normally, the total cash received every day is around RM 1,000 and above, and it can be 5 times higher at the beginning of the new month. Encik Zaki, the account assistant will make a cash deposit to the bank in the next following days. The bank in slips will be attached to the daily report after the deposits were made. The daily report will be used by Puan Aina to record in the MYOB Accounting System every week. She also prepares bank reconciliation every two months and authorized by Encik Mohd as Head of Account Department. Required: Assess any four (4) weaknesses in the internal control system in Aman Private School in situations in which there are substantial economies of scale, the ___________ of adding an additional customer is very _________ once the fixed costs of the overall system are in place.a. average variable cost, high b. marginal cost, low c. marginal revenue: low d. marginal cost; high A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect Public-key encryption is based on a ____.a.message authentication code (MAC)c.hash valueb.certificated.key The total population of the United States exceeds 328 million people. Many transactions each day are needed to feed, clothe, and shelter a population of this size. The number is huge. It all works because the US economic system distributes the output of farms and factories. This example shows that ___________. a. marketing is important to business b. marketing dominates supply chain activities c. distribution is the focus of marketing d. distribution is not part of marketing activities select all of the following that would be soluble in the dichloromethane layer of an extraction that utilizes water and dichloromethane as its liquid layers: group of answer choices cyclopentane sodium chloride ethoxypropane methylcyclohexane lithium acetate Which of the following is an example of foreign direct investment in China? A.Chinese Shenzen Airlines company buys a small U.S. midwest airline company, Air Chicago. B.A U.S. foreign exchange speculator buys $200,000 worth of the Chinese currency the yuan. C.U.S. auto entrepreneur Elon Musk buys stock in Alibaba Group Holding Limited of Hangzhou, China. D.The U.S. company Walmart buys a warehouse in Shanghai. E.The bank of China purchases U.S. Treasury bonds. Comment on the significance of each concept in terms of the role it plays in helping us to understand the nature of international economic relations.1. Internal economies of scale.2. A carbon tariff.3. The real exchange rate. Police infotainment tends to privilege which criminal justice frames? T/F. robust australopithecines had large chewing muscles but lacked a sagittal crest. how many moles of NH, will be produced if 3.5 moles of N2, are reacted completely You have configured your switches with the spanning-treevlan x root primary and spanning-tree vlan x rootsecondary commands. Which of the following tertiary switchwill take over if both switches fail?A. A switch with priority 4096B. A switch with priority 8192C. A switch with priority 12288D. A switch with priority 20480 increased collections is a benefit of a multidisciplinary approach to rcm? use the quadratic formula to find the exact solutions of x2 5x 2 = 0. the shoe co. manufactures and sells two lines of shoes. during the most recent accounting period, the black line and the brown line sold 15,000 and 2,000 units, respectively. the company's most recent financial statements are shown below: black brown sales $ 900,000 $ 240,000 less cost of goods sold: unit-level production cost 600,000 135,000 depreciation, production equipment 125,000 50,000 gross margin $ 175,000 $ 55,000 less operating expenses: unit-level selling and administrative costs 40,000 65,000 corporate-level facility expenses (fixed) 36,000 36,000 net income (loss) $ 99,000 $ (46,000 ) based on this information, the company should: a. keep the brown line because it contributes $55,000 to total profitability. b. eliminate the brown line because it is operating at a loss. c. keep the brown line because it contributes $40,000 to total profitability. d. it is impossible to determine with the given information. we need to know the number of products we have in the purchaseorderdetail table. (count the number of un-repeated productid) 8. (5 pts) what is (0.00034) x 48579? make sure the reported answers is rounded properly. a) 16.5 b) 17 c) 16.517 d) 16.52