In paragraphs 4 and 6, what effect do the phrases "unearthly laugh"
and “demoniac laughter" have on the meaning of the text?”from brute neighbors”

Answers

Answer 1

Answer: c

Explanation: is it a multiple question? if it is it's c. i had one like this


Related Questions

What is the major difference between literature adults read and the books adults read to children?

Answers

Answer: Children’s literature is written with child readers in mind. It is often written with children of a particular age group in mind, taking their reading ability into account. It is also written on topics that would most likely be of interest to children.

Adult literature is not written with child readers in mind. The language does not make concessions to the reading ability of children, and the plots and characters are usually written with adult readers in mind.

Explanation:

Child readers are considered when writing children's literature. It is frequently written with kids of a certain age group in mind, taking into account their reading skills. Additionally, it contains writing about subjects that kids are most likely to find interesting.

What is children's literature?

Written works and accompanying illustrations created to enlighten or entertain children make up children's literature.

Young children's literature can be categorized in a variety of ways. Concept, Predictable, Narrative, and Informational are the four main genres that can be used as a helpful starting point.

Children's readers are not considered when writing adult literature. The plots and characters are typically written with adult readers in mind, and the language does not make accommodations for children's reading abilities.

Thus, Child readers are considered when writing children's literature.

For more information about children's literature, click here:

https://brainly.com/question/29972844

#SPJ2

Which detail from “Run, Kate Shelley, Run” best supports the idea that people feel Kate should be rewarded for her actions?

A)“And after her death, the Order of Railway Conductors and Brakemen placed a memorial to their Iowa heroine.”

B)“The same telegraph that had warned Ogden Station to hold the midnight express sent news of Kate’s bravery from city to city.”

C)“Then the people of Iowa awarded her a gold medal, and the railroad gave her one hundred dollars and a lifetime railroad pass.”

D)“While Kate lay in bed recovering from that terrible night, every train passing the farmhouse blew its whistle in her honor.”

Answers

Answer:

C)“Then the people of Iowa awarded her a gold medal, and the railroad gave her one hundred dollars and a lifetime railroad pass.”

Explanation:

The detail from “Run, Kate Shelley, Run” that best supports the idea that people feel Kate should be rewarded for her actions is option C.

This is because, the people are awed by what Kate has done and truly believe that she should be fairly compensated and for that they gave her a gold medal, the railroad gave her a hundred dollars and a lifetime pass.

The detail that most adequately backs the idea that people believe Kate must be given reward for her deeds would be:

C). “Then the people of Iowa awarded her a gold medal, and the railroad gave her one hundred dollars and a lifetime railroad pass.”

The quotation "Then...pass" most adequately backs the idea regarding people's opinion that Kate needs to rewarded for her noble actions. The detail about her receiving "gold medal...one hundred dollars...railroad pass" shows that her actions require a better and fair reward. This also shows people owe her a lot and therefore, wants to compensate her for it.

Learn more about "Shelley" here:

brainly.com/question/3826067

I will mark brilliantest

Explain the following phrases in your own words with reference to the poem "where the mind is without fear"in one-two lines:-
(i)head is held high
(ii) Narrow domestic walls
(iii)From the depth of truth

Answers

Answer:

 i: "head is held high" refers to a sense of pride, and each person should walk with their heads held high without having to feel sorry for anything.

ii: "Narrow domestic walls" refers to the limits established between people.

iii: "From the depth of truth" refers to the good sense and honesty that each one should have in their hearts.

Explanation:

  This poem was written by Rabindranath Tagore and is a poem written in prayer form, since his country, India, at that time was under British rule.

He asks the inhabitants of his town to lose their fear, to walk with their heads up and be honest. He asks the almighty Father for the freedom of his people.

A Formidable Hunter
I remember well the great horned owl that sat on the windowsill of my kindergarten classroom. It was stuffed, of course, but quite imposing nonetheless. This grand specimen was nearly two feet long — with brown, white and rusty red feathers. Its yellow eyes were large and perfectly round, giving it a wise look. Its talons were thick and sharp, and on its brow two curved feathers stuck up, looking just like two horns. I got the impression that this bird was a great hunter.

Of the 145 species of owl, the great horned is the largest. Owls live in most parts of the world, ranging from tropical to subarctic climates. The elf owl is the smallest at only six inches, but no matter what their size, all owls are good hunters. They hunt under cover of night, so their prey can't see them. Unlike other birds, owls have large, soft feathers that allow them to fly without making noise, which also makes them good predators. Farmers like owls because they keep pests such as mice, voles, rats and even rabbits from their crops and stores of grain. And they have hearty appetites. Henry Williamson, a farmer in England, had eleven barn owls on his farm. He kept careful watch on their hunting habits and was astounded to find that together they ate 150 mice each night! While farmers may be grateful to owls, owners of cats and small dogs should beware: owls have been known to pluck up small pets that unknowingly wander into the birds' hunting zones.


Select the correct answer.
Why might it be difficult to keep an owl as a pet?

A.
Owls need to eat a lot of fresh mice daily.
B.
Owl feathers need a great deal of care.
C.
Owls need to live in subarctic temperatures.
D.
Owls need to sleep during the day.

Answers

Answer:

Owls need to eat a lot of fresh mice daily.

Explanation:

It doesn't say that they NEED a lot of mice, but it did say that was their diet and they are known to eat small animals that cross their path. This is the only option that makes sense.

According to the given excerpt, it is difficult to keep an owl as a pet because Owls need to eat a lot of fresh mice daily. Thus, option A is correct.

What is predators ?

In a biological interaction known as predation, one organism—the predator—kills and consumes another—its prey. It belongs to a group of widespread feeding strategies that also includes parasitism, micropredation, and parasitism.

Being an effective predator indicates that owls have certain abilities and strategies that they employ to successfully catch their prey.

The sample indicates that it is challenging to keep an owl as a pet, since they require a lot of fresh mice to eat every day. Therefore, choice A is correct.

Learn more about predators here:

brainly.com/question/10790484

#SPJ2

Item 2
Refer to the NASA article "Responding to Climate Change."

How does the text make a connection between greenhouse gases and climate change?


Agriculture uses greenhouse gases, helping to limit climate change.

Atmospheric greenhouse gases cause the earth to warm up, causing climate change.

Extreme weather events cause greenhouse gases to build up, which results in climate change.

Greenhouse gases cause the earth to cool down, which helps to limit climate change.

Answers

Answer:

b

Explanation:

sorry if im wrong!

Answer:

Atmospheric greenhouse gases cause the earth to warm up, causing climate change.

Explanation:

I took the test, so hope it helped :)

Students and parents, please join me in honoring Coach Parnell for the basketball team's winning season. As you know, we are the Bloomfield Bulldogs. Well, when it comes to improving our team, Coach Parnell has been a bulldog. He has met every challenge and refused to back down, even when things have been tough. We owe our new championship pennant to his determination, so give him a hand.


which option best describes the type of argument used in this speech?

A. An argument by analogy comparing Coach Parnell to a bulldog

B. An argument by authority based on the principal's position as leader of the school

C. An argument of ethics stating that how you play is more important than winning or losing

D. A cause-and-effect argument explaining the steps Coach Parnell took to lead the team to victory ​

Answers

Answer:

It's either A or C

Explanation:

Hope this helped!

Answer:

A

Explanation:

identify the main them of “ i have a dream “ martin luther king , ill mark brainlist !

Answers

Answer:

The main themes in the “I Have a Dream” speech include freedom for Black Americans, peaceful protest, and hope for the future. Freedom for Black Americans: Despite the promises of the Declaration of Independence, Black Americans are continually denied freedom.

Explanation:

Answer:

the theme of his speech mainly talks and involves freedom for Black Americans, peaceful protests, and hope for a better future. MLK expresses hope that one day, people will no longer be judged by their skin color in the United States and that there be peace and freedom among others.

Explanation:

as indicated in brackets.
1. The teacher was __________
happy with
Nalin's performance. (D)
2. He
goes out with his friends. (F)
3. Ali will visit the museum
4. Meher goes to the library
(F)
5. Kindly submit your home assignment
6. The news was
disturbing. (D)
7. The boy delivers the newspaper
8. I want everyone to be quiet
G. Fill in the blanks with adverbs of time (T). frequency F) OR​

Answers

I've found this question online. It is the following:

G. Fill in the blanks with adverbs of time (T) frequency (F) or Degree (D)as

indicated in brackets.

1. The teacher was _______ happy with Nalin’s performance (D)

2. He _______ goes out with his friends. (F)

3. Ali will visit the museum ________. (T)

4. Meher goes to the library _________. (F)

5. The news was _______ disturbing. (D)

6. Kindly submit your home assignment _________. (T)

7. The boy delivers the newspaper _________. (F)

8. I want everyone to be quiet ________. (T)

Answer:

G. Fill in the blanks with adverbs of time (T) frequency (F) or Degree (D)as

indicated in brackets.

1. The teacher was very happy with Nalin’s performance (D)

2. He always goes out with his friends. (F)

3. Ali will visit the museum tomorrow. (T)

4. Meher goes to the library weekly. (F)

5. The news was completely disturbing. (D)

6. Kindly submit your home assignment today. (T)

7. The boy delivers the newspaper daily. (F)

8. I want everyone to be quiet now. (T)

Explanation:

Adverbs are words that modify a verb, an adjective, or another adverb. They help express notions such as time, place, intensity, frequency, and manner. The exercise above asks us to use adverbs of time, frequency and degree to complete the sentences. Some common examples of each time are the following:

1. Time: today; tomorrow; yesterday; already; finally; after; before.

2. Frequency: always; seldom; never; usually; often; frequently.

3. Degree: almost; deeply; very; totally; completely; intensely.

Which is the correlating conjunction?
A. both...and
B. is...both
C. and a duty
D. and

Answers

Answer:

A. Both/And

Explanation:

Answer:

A.

its a just bc its a.....

Which of the following is an example of hyperbole?
A. Paul Bunyan was as tall as a mountain.
B. Paul Bunyan could chop a lot of wood.
C. Paul Bunyan smelled like a spring day.
D. Paul Bunyan built a big blue boat.

Answers

The answer is A and I know this because a hyperbole is an exaggeration and Paul Bunyan was as tall as a mountain is exaggerating his height

Passage: Kathy Jimson moved into our neighborhood in August. Right away, she started to change her front yard. She pulled out all the old vines and planted a simple garden that's easy to take care of.
Its most striking feature is a trail of Arizona river rock. These silver stones brighten the yard and are a good contrast to the plants. She has planted slow-growing garden juniper among the rocks. Their gray-green needles provide an excellent contrast to the stones.
The grass she chose, with its wonderful yellow spires, requires little water. The yellow mums, which also use little water, are great accents to the darker shrubs. At both corners, she has planted bright red roses that need little care.
All her shrubs are dwarf varieties that need little attention. In the center of the yard are a soft-leaf yucca tree and a Japanese maple tree. The whole yard is surrounded by a border of liriope flowers, which can survive on rainfall alone.

Question: What is this passage mainly about?
A. describing a simple garden
B. educating readers about fall plants
C. how to use river rock in a garden
D. fitting dwarf plants into a garden

Answers

A. A simple garden
BUT REALLY
It’s showcasing how Kathy copes with her family’s death by rejuvenating their family’s old garden, which was left to rot and decompose as years after the deaths she moved out and started deteriorating and eventually had to be put in a psych ward - after 8 months she got released and now she’s reminiscing about her nostalgic childhood when her family was still around to care for her.

Celeste likes to create fun stories as part of her narrative chains. She focuses on the words and how they all connect, and her favorite thing to do is act out a narrative chain with her friends. With what part of her brain does Celeste likely think?

A)Front brain
B)Left brain
C)Rear brain
D)Right brain

Answers

Answer:

D) Right

Explanation:

Answer:

Front Brain

Explanation:

I took FLVS test

Select the correct answer.
Selene considers herself to be a tactile learner. Which type of class would Selene do best In?
O A
a class focused primarily on Instructor lectures
OB.
a class that provides a lot of handouts or slideshow presentations
O c.
a class with a lab component
OD
a class that encourages group discussions
Reset
Next

Answers

Answer:

C

Explanation:

Tactile is for touching and feeling mainly so Lab would represent this statement.

Answer:

c. a class with a lab component

Explanation:

The phrase “nickel and dimed” is an example of
A.
irony
B.
euphemism
C.
metaphor
D.
hyperbole
E.
idiom

Answers

Answer:

I am guessing e. idiom

Explanation:

Only because Idiom refers to multiple  

Why should public school teachers get paid more reason why (100 words or more please real answers )

Answers

Yes, since he has no choice, nobody should. Is that the argument? Oh, by the way, he too would have a choice, maybe not in your small Texas town -but somewhere. Like taxicab oligopolies, public Schools have become a cabal of unions and corporations that benefit from a "national school system" attempting to deny to us any other options. They want to decide how your child's education dollars will be spent. To do this they must deny us any other options. The false dilemma you pose is that we can't offer great public education while simultaneously encouraging other options. You are, in effect, denying other children the very same specialized instruction that your example receives: smaller class sizes, more teachers per student, individualized learning plans, self pacing, safety from violence and bullying.

400 years on , Mayflower's legacy includes pride , prejudice

Answers

Answer:

Whats the question?

Explanation:

what is the best meaning for the word ruefully?
exuberantly
languidly
morosely
dispassionately​

Answers

Answer: C: Morosely

Explanation:

Answer:morosely

Explanation:

What did George tell Lennie to do if he ever got in trouble again?

Answers

Answer:

George tells Lennie to hide in the bushes near where they are camping.

Explanation:

Hope this helps

Answer:

George tells Lennie that if he ever gets in trouble, to come hide in the bushes and George will find him there.

In a thematic allegory, the characters and their actions often portray failing ______.

Answers

Answer:

actions

Explanation:

What is the tone of this sentence from “The Oldest and Youngest Places on Earth”?

It is unknown whether the earth's youngest island will last for long, but it has already exceeded expectations.


skeptical

optimistic

puzzled

neutral

Answers

Answer:

neutral

Explanation:

plz mark brainliest plz

Answer:

The correct answer is B) Optimistic

If a disparity was found in the vote count after the student election, would it mean that there was a clear winner?

Answers

Answer:YES

Explanation: Disparity means great difference so a disparity would indicate a clear winner.

It is true that if disparity was found in the vote count after the student election, it mean that there was a clear winner.

What is disparity?

Determining when a difference turns into a disparity can be challenging because a disparity is typically only detected after other variables that may have contributed to the difference have been statistically controlled for. Instead, a disparity is measured as a residual or a difference between two groups.

A discrepancy is a conspicuous difference, and disparity is the state of being unequal.

Disparity typically refers to an unfair discrepancy, such as the wage gaps between men and women in the same profession. Economic inequalities across ethnic groups also exist.

It is true that if there was a clear winner in the student election, as indicated by discrepancy in the vote total.

Thus, the given statement is correct.

For more details regarding disparity, visit:

https://brainly.com/question/15562045

#SPJ5

The old saying "To err is human" attests to the truth that we are all _________. a. fruitless

Answers

Is there more choices?
There isn’t enough choices

It all began with Effie's getting something in her eye. It hurt very much indeed, and it felt something like a red-hot spark—only it seemed to have legs as well, and wings like a fly. Effie rubbed and cried—not real crying, but the kind your eye does all by itself without your being miserable inside your mind—and then she went to her father to have the thing in her eye taken out. Effie's father was a doctor, so of course he knew how to take things out of eyes.

When he had gotten the thing out, he said: "This is very curious." Effie had often got things in her eye before, and her father had always seemed to think it was natural—rather tiresome and naughty perhaps, but still natural. He had never before thought it curious.

Effie stood holding her handkerchief to her eye, and said: "I don't believe it's out." People always say this when they have had something in their eyes.

"Oh, yes—it's out," said the doctor. "Here it is, on the brush. This is very interesting."

Effie had never heard her father say that about anything that she had any share in. She said: "What?"

The doctor carried the brush very carefully across the room, and held the point of it under his microscope—then he twisted the brass screws of the microscope, and looked through the top with one eye.

"Dear me," he said. "Dear, dear me! Four well-developed limbs; a long caudal appendage; five toes, unequal in lengths, almost like one of the Lacertidae, yet there are traces of wings." The creature under his eye wriggled a little in the castor oil, and he went on: "Yes; a bat-like wing. A new specimen, undoubtedly. Effie, run round to the professor and ask him to be kind enough to step in for a few minutes."

"You might give me sixpence, Daddy," said Effie, "because I did bring you the new specimen. I took great care of it inside my eye, and my eye does hurt."

The doctor was so pleased with the new specimen that he gave Effie a shilling, and presently the professor stepped round. He stayed to lunch, and he and the doctor quarreled very happily all the afternoon about the name and the family of the thing that had come out of Effie's eye.

But at teatime another thing happened. Effie's brother Harry fished something out of his tea, which he thought at first was an earwig. He was just getting ready to drop it on the floor, and end its life in the usual way, when it shook itself in the spoon—spread two wet wings, and flopped onto the tablecloth. There it sat, stroking itself with its feet and stretching its wings, and Harry said: "Why, it's a tiny newt!"

The professor leaned forward before the doctor could say a word. "I'll give you half a crown for it, Harry, my lad," he said, speaking very fast; and then he picked it up carefully on his handkerchief.

"It is a new specimen," he said, "and finer than yours, Doctor."

It was a tiny lizard, about half an inch long—with scales and wings.

So now the doctor and the professor each had a specimen, and they were both very pleased. But before long these specimens began to seem less valuable. For the next morning, when the knife-boy was cleaning the doctor's boots, he suddenly dropped the brushes and the boot and the blacking, and screamed out that he was burnt.

And from inside the boot came crawling a lizard as big as a kitten, with large, shiny wings.

"Why," said Effie, "I know what it is. It is a dragon like the one St. George killed."

And Effie was right. That afternoon Towser was bitten in the garden by a dragon about the size of a rabbit, which he had tried to chase, and the next morning all the papers were full of the wonderful "winged lizards" that were appearing all over the country. The papers would not call them dragons, because, of course, no one believes in dragons nowadays—and at any rate the papers were not going to be so silly as to believe in fairy stories. At first there were only a few, but in a week or two the country was simply running alive with dragons of all sizes, and in the air you could sometimes see them as thick as a swarm of bees. They all looked alike except as to size. They were green with scales, and they had four legs and a long tail and great wings like bats' wings, only the wings were a pale, half-transparent yellow, like the gear-boxes on bicycles.

Based on the rising action in the bolded paragraphs, what do we know about Daddy?

He is calm and curious.
He is angry and upset.
He is hysterical.
He is uninterested and bored.

Answers

Answer:

A. He is calm and curious

Explanation:

Hope this helps :)

Question 1
Refer to the U.S. Department of Energy's "Guide to Renewable Energy."

Part A

Which inference can be made from the text?


Most renewable energy systems are all the same.

Renewable energy is the best way to fight climate change.

Renewable energy systems are for private homes only.

Making your home energy efficient is good for your finances.
Question 2
Part B

Which evidence from the text best supports the answer in Part A?


"Geothermal heat pumps are one of the most efficient ways to heat and cool your home."

"Wind turbines use the motion of the wind to turn a shaft attached to a generator, which makes electricity."

"Homeowners can save money by making their homes as energy-efficient as possible."

"Solar energy can generate all or some of a home’s electricity needs…."

Answers

Answer:

Renewable energy is the best way to fight climate change.

Geothermal heat pumps are one of the most efficient ways to heat and cool your home."

Explanation:

According to the U.S. Department of Energy's "Guide to Renewable Energy.", the inference that can be made from the text is that renewable energy is the best way to fight climate change.

The sentence that supports this answer is Geothermal heat pumps are one of the most efficient ways to heat and cool your home."

What is the author’s main purpose in the passage?
A. To inform readers about the ways Europeans abused and oppressed the native peoples of the Americas, provoking readers' outrage.
B. To entertain readers with an account of the relations between Europeans and the native peoples of the Americas, increasing readers' awareness.
C. To inform readers about the ways native peoples of the Americas assisted Europeans with food and labor, inspiring readers' admiration.
D. To entertain readers with a comparison of the food consumption of Europeans and the native peoples of the Americas, eliciting readers' sympathy.

Answers

Answer:

Your answer is C. To inform readers about the ways native people of the americas assisted Europeans with food and labor, inspiring readers admiration.

In poetry, the term speaker refers to the
O main character.
O narrator.
O poet.
O reader.

Edge2020

Answers

Answer:

narrator

Explanation:

narrator is the one speaking

main character is the spotlight person (if that makes sense)

poet is the person who wrote it

reader is the person reading it

In poetry, the term speaker refers to the narrator, poetry has a speaker, who serves as the poem's voice, much like fiction does, hence option B is correct.

What is narration?

A narrative is told to an audience by narration, which can be done either orally or in writing. A narrator, who can be a particular person or an ambiguous literary voice, conveys the story's information to the audience, especially concerning the plot of the sequence of events.

The speaker is frequently the poet. Other times, the speaker can adopt an alter ego, speaking as an animal or inanimate object, among others. The narrator is a made-up character that the author uses to convey the story. It's the vantage point from which the narrative is told.

Therefore, in poetry, the term speaker refers to the narrator, hence option B is correct.

Learn more about narration, here:

https://brainly.com/question/27927201

#SPJ7

Unscramble the letters to find out what materials we’ll need to fix the gingerbread house with these letters.
D,M,U,O, S,G,R,P.

Answers

Answer:

Gumdrops

Explanation:

Gumdrops...... don’t thing there is any other words

Okay so I'm supposed to write a Sherlock Holmes story.
It goes "The Incident of the Maniacal Teenager" (Sounds like a odd name i know but there are stranger names like "The Fate of the Lurking Waffle")
I need Ideas please.

Answers

Answer: sherlock meets harry potter

Explanation: Sherlock is investigating a report of a magic killer so holmes is trying to find an explination where he runs into Harry potter fighting voldemort and then voldemort runs away and holmes teames up with potter to stop him and then they meet voldemorts apprentice who is an evil teenager hence the name manaical teenager.

How is the exponential increase of information that we process in all forms of media affecting the way we live?

Answers

Answer:

LOL i don't even know

Explanation:

Answer:

I got 2 answer

Explanation:

1. Working with new information.

This includes instances where communication and social interaction are needed to define the problem and gather necessary information from other people.

2.Carrying out non-routine manual tasks.

While robots will continue to improve dramatically, they are currently not nearly as capable as humans in conducting non-routine manual tasks.

10) It is MOST logical to infer that A) The author supports greater use of public transportation B) The author is employed by the public transportation system. The Corporate Average Fuel Efficiency program ended in 1999. D) The author is concerned about too much government interference.​

Answers

Answer:

D

Explanation:

It might be wrong, because I don't know what book. Above is the most logical though.

It is logical to infer that the author supports greater use of public transportation. The correct option is A.

What is the use of public transportation?

It eases traffic in towns and cities. Compared to buying and maintaining an automobile, public transportation is less expensive. Bus lanes and other bus priority measures have eliminated the need to wait in rush-hour traffic. Your carbon footprint is diminished.

Many transit choices, including buses, light rail, and subways, are part of public transportation systems. These services run on schedules, are open to the general public and may charge a fare.

A specific distance is often covered by public transportation with around half the energy needed for the same distance to be covered by a private car, an all-terrain vehicle (SUV), or a light truck. As a result, it is reasonable to declare that choice is the most rational.

Thus, the ideal selection is option A.

Learn more about public transportation here:

https://brainly.com/question/28270267

#SPJ5

Other Questions
PLEASE HELP !!!Match each example of informal language on the left with the corresponding example of formal language on therightJin always had grand plans that wouldMost likely to star on Broadwaytake months to accomplish.During the school play in 2012, MiguelMotto: Dream bigfell but continued singingRemember when... you fell in theA spirited girl, Zola led the pep ralliesschool play but kept on singing?and sales of school shirtsFrom 2008 to 2012. Eva has starred inMost school spiritevery school play 4. Discuss the role of necrohormones Let f(x) = 9x and g(x) = x + 7. What'sthe smallest number that is in the domain offg?Enter the correct answer.OOOODONEClear all what was the strength and weakness of Adam Smith and David recardo A man travels 320 miles in 8 hours. If he continues at the same rate, how many miles will hetravel in the next 2 hours? what is the largest prime number? what should be added2x ^3+ 3x^2+8x-4to get 0 ? pls help asap! This homework is really hard what is the meaning of zest Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ?