if you can buy 3 loaves of bread for $5 how many loaves can you buy for $12

Answers

Answer 1

Answer:

You can buy 6 because it cost 2.50 for 1 loaf

Step-by-step explanation:


Related Questions

Simplify. 3/4−4x+1/2x−1/2+1/2x Enter your answer in the box. Do not use decimals in your answer

Answers

Answer:

-3x+1/4

Step-by-step explanation:

hope this helps!

Answer:

-3x+1/4

Step-by-step explanation:

i got it right on k12

Multiply. Write in simplest form. 2 1/2 x 1 1/2

Answers

Answer:

3.75 or 3 3/4

Step-by-step explanation:

Answer:

3.75 or 3 3/4

Step-by-step explanation:

2 1/2 or 2.5 x 1 1/2 or 1.5 is 3 3/4 or 3.75

Hope it helps!

whats the slope intercept form of 5x-14y=-10

Answers

Answer: y = 5/14x + 5/7

Step-by-step explanation: write in slope intercept form y =mx + b

8 less than the product of 6 and a number is the same as twice the number diminished by 10

Answers

6x - 8 = 2x - 10

This is the equation

please help me<3
i will give brainliest to the right answer

Answers

Answer:

26.5

Step-by-step explanation:

Because the sales is $530 and the commission rate is 5%, the commission would be 5% of the sales, which would be $26.5

Linden Middle School has 480 students. The number of students is increasing by 5% next year
How many students will there be? (Please do step by step)

Answers

Answer:

Please do step by step)

hope I gave

in the coordinate plane, triangle ABC has vertices A(1,-2), B(1,0.5), and C(2,1) and triangle DEF has vertices D(4,-3), E(4,2), and F(6,3). The triangles are similar because DEF is the image of ABC under a dilation with center (_,_) and scale factor ___.

PLEASE HELPP​

Answers

Answer:

(A) the center of dilation is at (-2,-1)

(E) the scale factor is 2

The triangle DEF is a dilation of triangle ABC with center of dilation at (0,0) and scale factor of 0.5.

What is Triangle?

A triangle is a three-sided polygon that consists of three edges and three vertices.

The ratio of the lengths of corresponding sides of triangles ABC and DEF.

AB and DE are corresponding sides, so:

AB/DE = (distance between A and B) / (distance between D and E)

= 2.5 / 5

= 0.5

BC and EF are corresponding sides, so:

BC/EF = (distance between B and C) / (distance between E and F)

=1.118 / 2.236

= 0.5

AC and DF are corresponding sides, so:

AC/DF = (distance between A and C) / (distance between D and F)

AC/DF = 2.236 / 4.472

= 0.5

We see that all three ratios are equal to 0.5.

Hence, the triangle DEF is a dilation of triangle ABC with center of dilation at (0,0) and scale factor of 0.5.

To learn more on Triangles click:

https://brainly.com/question/2773823

#SPJ1


What is an equation of the line that passes through the points (-2, 1) and (-6,-5)

Answers

Answer:

y=3/2x+4

Step-by-step explanation:

I am pretry sure

WILL GIVE BRAINLIEST

just need answer:)

Answers

I think its b im sure
I think the answer is b

A pizza with one topping costs $11.
Each additional topping costs $2
more. Write a recursive formula
and an explicit formula for the
situation.
explicit formula:
recursive formula:

Answers

Given:

A pizza with one topping costs $11. Each additional topping costs $2  more.

To find:

The recursive formula  and an explicit formula for the  situation.

Solution:

The sequence of costs of pizza is

11, (11+2), (11+2+2), ...

11, 13, 15, ... are in A.P.

Here,

First term: a=11

Common difference: d=2

Explicit formula of an A.P. is

[tex]a_n=a+(n-1)d[/tex]

where, a is first term and d is common difference.

[tex]a_n=11+(n-1)2[/tex]

[tex]a_n=11+2n-2[/tex]

[tex]a_n=9+2n[/tex]

Therefore, the explicit formula for the  situation is [tex]a_n=9+2n[/tex].

Recursive formula of an A.P. is

[tex]a_n=a_{n-1}+d[/tex]

Where, [tex]a_1[/tex] is first term and d is common difference.

[tex]a_n=a_{n-1}+2[/tex]

Where, [tex]a_1=11[/tex].

Therefore, the required recursive formula is [tex]a_n=a_{n-1}+2[/tex] where [tex]a_1=11[/tex].

PLEASE I NEED HELP AND I ONLY HAVE AN HR Question 2 (4 points)
(04.02)

Determine whether the graph represents a proportional relationship. (4 points)

A graph is shown. The x-axis is labeled from 0 to 9. The y-axis is labeled from 0 to 15. Four points are shown on the graph on ordered pairs 0, 2 and 1, 6 and 2, 10 and 3, 12. These points are joined by a line. The label on the x-axis is Number of cars. The title on the y-axis is Number of wheels.

a
Yes, it is a proportional relationship because the graph goes through the origin

b
Yes, it is a proportional relationship because the graph is a straight line

c
No, it is not a proportional relationship because the graph is not a straight line

d
No, it is not a proportional relationship because the graph does not go through the origin

Answers

------> The Answer Is C <------

Hope this helps have a good day :D

6. A ball is selected at random from a bag containing
3 red balls, 4 black balls and 5 green balls. The
first ball is replaced and a second is selected. Find
the probability of obtaining:
(a) two red balls,
(b) two green balls.

Answers

Answer:

two green balls

Step-by-step explanation:

because of many reasons boy

Answer:

a. 1/16   b. 25/144

Step-by-step explanation:

Since the bag does not change each time, the probability stays the same. To get the desired outcome both times, we must square the probability.

Genna purchased a pair of shoes on a web site.The original price of the shoes was $120. She used the coupon code to receive a 20% discount. The web applied a 15% service fee to the discounted price. Genna's shoes were less than the original price by what percent

Answers

Answer:

use calculater

Step-by-step explanation:

And this is Ari, signing off

Answers

Answer:

Byeee again haha

Step-by-step explanation:

Yea I'm answering this question again

A specific moderator deleted a lot of my answers almost all at once and for the reason that I didn't answer the question the people were asking, it's pretty weird as all the questions were either free points or very extremely straightforward questions like "what dynasty started the great wall" and usually when a moderator sees those they delete them but they just deleted my answer for almost no reason haha

Well if u see this then have a great day!

Answer:

ok :)

Step-by-step explanation:

What is the length of AC on a right triangle 84 156-x 7

Answers

Answer:

144

Step-by-step explanation:

i just took the test

If 12 cookies cost $3 how much would it be for 9 cookies

Answers

$36 is the answer :)
you use ratios. if 12 whole cookies cost only 3 dollars.
12:3
9:x
x is how much it would cost. so try to find x.
x= 2.25
9 cookies cost 2 dollars and 25 cents

Prepare the journal entry to record the issuance of 5,000 shares of $20 par common stock for $25 per share

Answers

Answer:

value preferred stock for $65,250 cash

HOPE THIS HELP PLEASE TOUCH THANKS.

cos(0)=square root 3/3, sin 0<0. what is the value of sin0​

Answers

Answer:

sin θ = [tex]\frac{\sqrt{6} }{3}[/tex]

Step-by-step explanation:

Given that,

cos θ = [tex]\frac{\sqrt{3} }{3}[/tex]

From the trigonometric functions,

cos θ = [tex]\frac{adjacent}{hypotenus}[/tex]

⇒ adjacent = [tex]\sqrt{3}[/tex], and the hypotenuse = 3

Let the opposite side be represented by x, applying the Pythagoras theorem we have;

[tex]/hyp/^{2}[/tex] = [tex]/adj/^{2}[/tex] + [tex]/opp/^{2}[/tex]

[tex]/3/^{2}[/tex] = [tex](\sqrt{3} )^{2}[/tex] + [tex]x^{2}[/tex]

9 = 3 + [tex]x^{2}[/tex]

[tex]x^{2}[/tex] = 9 - 3

   = 6

x = [tex]\sqrt{6}[/tex]

Thus, opposite side = [tex]\sqrt{6}[/tex]

So that,

sin θ = [tex]\frac{opposite}{hypotenuse}[/tex]

        = [tex]\frac{\sqrt{6} }{3}[/tex]

Therefore,

sin θ = [tex]\frac{\sqrt{6} }{3}[/tex]

Andrew swims 22 laps at the same rate, how long does it take him

Answers

Answer:

who knows

Step-by-step explanation:

who knows

Solve for a .

5.4 = a - (-1.8)


a =

Answers

5.4=a+1.8
5.4-1.8=a
a=3.6

Answer:

3.6 = a

Step-by-step explanation:

5.4 = a - ( -1.8)

Distribute minus sign.

5.4 = a + 1.8

Move constant to the left hand side and change their sign.

5.4 - 1.8 = a

3.6 = a

Select all expressions that are equivalent to 8.8.8.8.8

Answers

Answer:

the first one

the third one

and the forth one

Step-by-step explanation:

they all add up to the same amount

what are the coordinates of the point X'if the image is rotated 90° counter clockwise​

Answers

Step-by-step explanation:

When rotating a point 90 degrees counterclockwise about the origin our point A(x,y) becomes A'(-y,x). In other words, switch x and y and make y negative

⚠️HELP PLZ TIMED⚠️
What is the least common denominator of the equation 3/4(x-3)-1/2=2/3
O 2
O9
12
O 36

Answers

I’m pretty sure it’s 12 don’t take my advice tho just saying

A group of friends wants to go to the amusement park. They have $79.50 to spend on parking and admission. Parking is $19.50, and tickets cost $10 per person, including tax. Write and solve an equation which can be used to determine x, the number of people who can go to the amusement park.

Answers

Answer:

x = 6. six friends can go.

Step-by-step explanation:

79.50 - 19.50 = 60.00

60/10 = 6 people

The number of people that can go to the amusement park is six.

The information in the question can be represented with this equation:

Total amount the friends have = cost of parking + (cost of ticket x number of friends)

$79.50 = $19.50 + $10 × x

$79.50 = $19.50 + $10x

The equation that would be used to solve for the number of friends that can go to the amusement park, the equation that would be used is: $79.50 = $19.50 + $10x

Combine similar terms

$79.50 - $19.50 =  $10x

$60 = $10x

Divide both sides of the equation by 10

$60 / $10 = x

x = 6

A similar question was answered here: https://brainly.com/question/20471133?referrer=searchResults

Write a linear function f with the values f(0) = 1 and f(-2)=-3,
Oy=-2x-3
O y = x + 2
O y = 2x + 1
O y=-3x + 1

Answers

y=2x +1

For f(0)=1 replace x by 0 and for f(-2)=3 replace x by -2

Consider best strategy to solve the problem.
On a field trip, the ratio of teachers to students is 1:25. If there
are 5 teachers on the field trip, how many students are on the
trip?

Answers

5:1,25=4

1/4 teacher plus for echipa studenta.

Solve for y given the lines are parallel

Answers

Answer:

I believe the y is parallel :)))))))))

Answer:

35 degrees

Step-by-step explanation:

70 divided by 2 is 35.

And both sides are equal to each other bc the lines are parallel.

Write an equation of the line that passes through the given point as is (a) parallel and (B) perpendicular to the given line

A. y=
B. y=

Answers

A: y=-4x+19
B: y=1/4x+2

PLease help with mathhh

Answers

Answer:

its is the 3rd one lol

Answer:

It would be the fourth option, -4/3 p + (-2/5)

Step-by-step explanation:

Notice that there's a positive sign followed by a negative sign, when we simplify this it becomes a negative sign. So simplified, this expression would be -4/3 p - 2/5, which makes it the closest to the given expression.

EDIT:

I just realized that there's more than one option, hence the instruction. So I looked through the options again and I believe the other answer would be -2/5 - 4/3 p (second option) -- the fractions only switched places unlike the other expressions where the negative/positive signs aren't equivalent to the given fraction.

Give the domain and range.

Answers

A should be correct


Hope it helps

Answer:

option a is correct answer

Other Questions
Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ........... A technician has a recipe for 32,500 mL; what is this in liters? -(4x - 7) + 1 = 2 (5 - 2x) solve for x You will start at the begining of the piece each time you practice. . True O B. False