If an astronaut had a mass of 30 kg on the moon, what would his mass be on Earth?

Group of answer choices

His mass would stay the same on Earth.

His mass would increase due to gravity on Earth.

His mass would decrease due to gravity on Earth.

His mass would change depending on the gravitational force.

Answers

Answer 1
B. His mass would increase due to gravity on Earth.
Answer 2

Answer:

B

Explanation:


Related Questions

To what genre can rhapsody in blue most closely be compared?

Answers

Concerto is the genre with which Rhapsody in Blue can best be then compared

Rhapsody is also a musical composition known for its improvisation and irregular forms. Perhaps the most famous piece of this type of music is George Gershwin's Rhapsody in Blue, composed in 1924. It is a series with a very contrasting atmosphere. "Bohemian Rhapsody" is called "Bohemian Rhapsody" because it describes the life of a "bohemian", whose original meaning is "artist", and "rhapsody" is a fantasy (literally the possibility of playing in his head). ) or vision. In this song, Freddie Mercury symbolically foreshadows his life. An ecstatic expression of emotion or excitement. A guide to life that brings a fresh perspective from God's Word every day. It includes the theme of the day, the theme verse, the message of the day, the daily confession, and the Bible reading plan portion. Take some quiet time to focus and pay attention to the topic of the day.

To know more about Rhapsody visit:

https://brainly.com/question/1383736?referrer=searchResults

#SPJ4

What are the 4 responsibilities of the FCC?

Answers

Encouraging the creation of cutting-edge services. Investigating complaints and assessing them. Homeland security and public safety. Education and information for consumers.

What actions does the FCC take?

Examines possible technical rule violations, such as unauthorised construction and operation, EAS, tower lighting and marking, radio frequency interference, and excessive power, and, as required, advises or takes enforcement action against broadcast licensees.

What kind of authority does the FCC have?

The FCC's ability to respond to grievances regarding the content of radio or television programming is restricted by law. All kinds of communication, including cable, radio, television, satellite, and others, are governed by the Federal Communications Commission. The Commission works to promote communication while preserving a healthy and vibrant market.

To know more about technical rule :

https://brainly.com/question/9330553

#SPJ4

carrie recently quit her job, packed up her car, and drove to las vegas, where she gambled away her entire life savings in 24 hours. based on this, carrie may be experiencing select one: a. obsessive-compulsive disorder. b. a manic episode. c. depression. d. a panic attack.

Answers

According to the research, the correct answer is Option B. Carrie recently quit her job, packed up her car, and drove to Las Vegas, where she gambled away her entire life savings in 24 hours. Based on this, Carrie may be experiencing a manic episode.

What is a manic episode?

It is a specific period during which the euphoric mood or irritability together with the alternating presence of phases of endogenous depression constitutes the so-called manic-depressive psychosis.

In this sense, there is a tendency to have a flight of ideas or subjective experience that the thought is accelerated, distractibility or a tendency for attention to be diverted towards irrelevant external stimuli.

Therefore, we can conclude that according to the research, a manic episode is a clinical picture that occurs episodically and is characterized by abnormal euphoria and disinhibited behavior.

Learn more about manic episode here: https://brainly.com/question/28099763

#SPJ1

How do Vietnamese show respect to elders?

Answers

Vietnamese show respect to elders by bowing their heads and/or hands when greeting them, addressing them with respectful titles such as “ông” (grandfather) and “bà” (grandmother), and allowing them to lead the conversation.

Showing Respect to Elders in Vietnamese Culture

Vietnamese people show respect to elders by addressing them with formal titles such as 'Ong' (for an older man) or 'Ba' (for an older woman).

Young people will also often bow to an elder in greeting and wait for the elder to speak first in a conversation. They will also listen to elders with respect, allowing them to speak uninterrupted. Additionally, Vietnamese people often avoid sitting higher than an elder, instead sitting or kneeling lower to show respect.

Learn more about Vietnamese people at: https://brainly.com/question/18979585

#SPJ4

What are the 2 key ideas of the Protestant Reformation?

Answers

The 2 key ideas of the Protestant Reformation include the Bible is the sole authority for all matters of faith and conduct and that salvation is by God’s grace and by faith in Jesus Christ.

It has been seen that Protestant Reformation is known to be a religious movement that started during the sixteenth century, brought an end to the ecclesiastical unity of medieval Christianity in western Europe, and greatly reshaped the process of modern history. Traditionally, the word reformation means the removal of dirt such as corruption from church institutions and people. The reformers were not first called Protestants, but the term later was applied to all groups as opposed to the orthodoxy of the Catholic Church.

To know more about Protestant Reformation:

https://brainly.com/question/369126

#SPJ4

Why is the power of empathy important in human relationships?

Answers

A strong factor that supports societal harmony and collaboration is empathy. It is the system that enables people to read and interact to others. Prior to relationship, trust, and loyalty, empathy is required.

What distinguishes empathy from sympathy?

This capability for empathy and understanding to others is a sign of our level of empathy. The emotion of pity for just another is more like sympathy. While pity is our satisfaction at not experiencing a person's issues, empathy is our capacity to comprehend how they feel.

Is the inability to empathize a mental illness?

The Diagnostic and Edition Of the Diagnostic (DSM-V) does not classify lack of empathy syndrome as a mental condition, although it may be one of several warning symptoms of a severe mental illness.

To know more about Empathy visit:

brainly.com/question/1159354

#SPJ4

additional powers that are necessary to carry out the specific responsibilities of the president are set forth in the constitution. they are known as

Answers

These powers and responsibilities are known as the "executive powers" of the president, and they include the authority to:

Serve as the commander-in-chief of the armed forcesMake treaties with the approval of the SenateNominate federal judges and other officials, with the approval of the SenateVeto or sign into law legislation passed by CongressIssue executive orders and presidential directivesGrant pardons for federal crimes

Which filter regions have a concentration gradient between the blood and dialysate?.

Answers

(I and II) are filter regions that have a concentration gradient between the blood and dialysate.

Both filter regions (I and II) exhibit concentration gradients due to the concentration difference between the urea contained in the blood and the urea concentration detected during dialysis.

Urea in the blood diffuses into the dialysate with a lower urea concentration due to the different concentration gradients in the filter area between the blood and the dialysate.

The efficiency difference (in terms of urea clearance) of modern filters is about 20% when comparing co-current and counter-current arrangements.

To learn more about dialysate, here:

https://brainly.com/question/29751810

#SPJ4

What happens if I am unfit to work?

Answers

A person is considered "unfit for work" when they have a physical condition or illness that prevents them from working for a living.

Normally this assignment implies that the singular will then be qualified for government help or some likeness thereof, for example, Federal retirement aide Incapacity benefits. The process by which nature selects which organisms will survive and which will die is known as natural selection.Every organism in a population is subject to variation. Some people are better people than others.Better chances of survival are available to organisms that can change and adapt to their surroundings.

Darwin coined the phrase "Survival of the Fittest," which refers to the process by which a species evolves through natural selection.Genes that are better suited to the environment are passed down from one generation of an organism to the next. Eventually, only those organisms with that gene will make up the population.Darwin's finches are an illustration of natural selection.

Learn more about natural selection here:

https://brainly.com/question/28163757

#SPJ4

more than the citizens of perhaps any other nation, americans define their relationships with one another and with political authority in terms of what?

Answers

More than the citizens of perhaps any other nation, the American citizens define their relationships with one another and with political authority in terms of rights that they hold.

The rights granted to the citizens of the United States are directly in relation to the powers and functions that they have to fulfill under the scope of the constitution. These rights are protected under the amendments made into the provisions of the national constitution. Moreover, the citizens cannot hold the right for more than themselves.

Learn more about rights here:

https://brainly.com/question/5369828

#SPJ4

What Elon Musk said about Taj Mahal?

Answers

Answer:Truly a wonder of the world

Explanation:Elon Musk described Taj Mahal as "truly a wonder of the world". (File) Billionaire entrepreneur Elon Musk on Tuesday recalled his 2007 trip to India including a visit to the Taj Mahal, which he described as "truly a wonder of the world".

Why is Hector honorable in the Iliad?

Answers

Answer:

He is a loving husband and devoted father, as well as devoted son and sibling. He did not hurt his brother when he confessed he would rather sleep around than go into battle. Hector fights in his kingdom, unlike any of the Achaean commanders do, which shows even more honor.

Explanation:

What are the three main stages of the policy making process quizlet?

Answers

Setting an agenda. placing an issue on the radar of policymakers who are paying close attention. creating potential fixes for the issue. creating decisions.

Putting a topic on the political calendar so that Congress can address it is the first step in the policy-making process. any initiatives taken by the government to help certain groups, such as the elderly, the ill, and the destitute.

Agenda setting refers to placing the topic on the official list of concerns that need to be handled by presidents, cabinet members, the Congress, the Parliament, or ministers of health, finance, or other pertinent ministries.

A principle is a standard or rule of thumb that is essentially applicable everywhere. The two types of principles are prescriptive and descriptive.

To learn more about policymakers please click on below link

https://brainly.com/question/14171518

#SPJ4

Who started the women's right to vote?

Answers

Elizabeth Cady Stanton, Susan B. Anthony, and Lucretia Mott started the women's right to vote.

Women have long been denied the right to vote in many societies around the world. This is despite the fact that women make up half the world's population and are just as capable as men. The main goals of the suffrage movement were to achieve equality for women and to give women a voice in the political process.

Women's right to vote is a fundamental human right and must be respected. There are many countries which have yet to grant women this right, but fortunately, progress is being made. The Suffrage movement was a political movement that fought for women's right to vote in the late 19th and early 20th centuries.

To know more about vote, click here.

https://brainly.com/question/21093353

#SPJ4

What is the role of government in supporting entrepreneurs?

Answers

The government's role in supporting entrepreneurs is to facilitate entrepreneurs to develop their businesses.

What does entrepreneur mean?

An entrepreneur is a person who establishes a company in an innovative way. There are various types of business fields, for example in agriculture, animal husbandry, fisheries, trade and industry.

One of the supports that the government can provide for entrepreneurs is to provide loans through commercial banks as an expansion of business capital loans.

With so many entrepreneurs, it has the potential for great growth in employment opportunities as well as increased income and various types of investment and investment to support these businesses.

Learn more about entrepreneurs here :

https://brainly.com/question/13897585

#SPJ4

why is it that law enforcement officers are normally not allowed to collect reward money offered for the capture and conviction of criminals? a. accepting a reward would violate principles of promissory estoppel. b. the officers have a preexisting legal duty to apprehend criminals. c. the officers have a preexisting moral duty to apprehend criminals. d. the rewards would unjustly enrich individual officers at the expense of the rest of the force.

Answers

Because law enforcement agents have a previous legal obligation to arrest criminals, they are often not permitted to take award money provided for the detention and conviction of criminals.

Who are the so-called criminals?

Criminals are those who violate the law. Criminal behavior includes theft, murder, and filing false financial records. Your initial impression of criminals may be of a horrible person, such as a killer.

Criminals are they guilty?

Any remorse they do feel is related to unfavorable outcomes they personally encounter. Although they are sorry they was caught, they do not lament what they did. Criminals who occasionally show regret have been seen.

To know more about Criminals visit:

https://brainly.com/question/29343393

#SPJ4

What was one of the results of the Schenck decision?

Answers

United States, 249, 47 (1919) If the speech is designed to incite criminal behavior and there is a real and immediate danger,the First Amendment does not protect the speaker from legal punishment Schenck decision.

What consequences resulted from the Schenck decision, which eliminated protections?

Speech that poses a "clear and immediate danger" is not protected speech pursuant to the First Amendment, the Supreme Court declared in Schenck v. United States (1919). This ruling illustrates how, occasionally, the Supreme Court's interpretation of the First Amendment sacrifices personal autonomy in favor of preserving social order.

Did Schenck win or lose the case?

Schenck's conviction was upheld by the Supreme Court in a unanimous ruling authored by Justice Oliver Wendell Holmes.

To know more about Schenck decision visit:-

https://brainly.com/question/30092719

#SPJ4

true or false: prolonged engagement in the field setting can improve rigor because it provides the researcher with more data, and data across a range of experiences.

Answers

Answer:

true

Explanation:

The use of prolonged engagement allows the research study to go farther in the investigation of certain phenomena that cannot be adequately explored with short-term study designs.

Rigor is best achieved through thoughtful and deliberate planning, diligent and ongoing application of researcher reflexivity, and honest communication between the researcher and the audience regarding the study and its results.

hope this helps. pls mark BRAINLIEST

What was the question the Supreme Court had to answer in the case of Baker v Carr when the case was appealed?

Answers

A crisis in the legitimacy of the Supreme Court's authority might have resulted from the state legislature's refusal to carry out the ruling.

A legislatures is an assembly with the power to enact laws for a political unit, such as a nation or city. They are frequently contrasted with the legislative and judicial branches of the government.

Primary legislation is the term typically used to describe laws passed by legislatures. Additionally, legislatures have the power to oversee and direct governmental acts and change the budget at issue.

Legislators are those who serve in a legislature. While indirect election and appointment by the executive are frequently employed, especially for bicameral legislatures with an upper chamber, the popular election is the most common method of selection for lawmakers in democracies.

The Legislative Department is primarily responsible for developing all major pieces of legislation for the Central Government, including bills to be introduced in Parliament and presidentially promulgated ordinances.

Learn more about legislatures here:

https://brainly.com/question/967090

#SPJ4

What are the 4 limited resources?

Answers

The four limited resource land, labor, capital, and entrepreneurship

What are limited resources?

The term "limited resources" denotes the economy's access to a finite amount of productive resources. The amount of labor, money, land and entrepreneurial activity that the economy can use for production is finite.

Although it may have a lot of those resources, its supply is NOT limitless.

In relation to natural resources Oil, coal, and natural gas are a few examples of scarce resources that are in high demand. Non-renewable resources are those that are typically in short supply and are depleted upon use because their sources are unrenewable.

Nonrenewable resources such as oil, coal, and natural gas are examples of high-demand limited resources. Non-renewable resources are those that are generally scarce in quantity and whose consumption depletes them because their sources cannot be replenished.

Learn more about limited resources here:

https://brainly.com/question/24371586

#SPJ1

Which of the following statements best relates to the information shown in the infographic?

Despite many attempts at reform, some members of the federal bureaucracy are still hired through political patronage.
Like most businesses, the federal government has to seek out well-qualified and diverse job candidates.
Specialized skills, such as a background in STEM, are less important than a degree in political science for most jobs in the bureaucracy.
Most members of the federal bureaucracy work near Washington, D.C., or in state capitals

Answers

Correct answer is B. Like most businesses, the federal authorities has to are trying to find out well-qualified and numerous job candidates.

What is in the federal government?

The Federal Government is composed of three awesome branches: legislative, executive, and judicial, whose powers are vested through the U.S. Constitution in the Congress, the President, and the Federal courts, respectively.

What is the major electricity of the federal government?

These enumerated powers include, amongst different things, the energy to levy taxes, adjust commerce, establish a uniform regulation of naturalization, establish federal courts (subordinate to the Supreme Court), establish and hold a military, and declare war.

Learn more about federal government here:

https://brainly.com/question/985210#SPJ4

according to the textbook, the invention and popularity of which device first made it possible for viewers to record television programs for later viewing?

Answers

The invention and popularity of the VCR (Video Cassette Recorder) first made it possible for viewers to record television programs for later viewing. In the late 1970s, the VCR revolutionized the way people watched television.

Prior to the popularization of the VCR, viewers were limited to only watching shows when they aired live. With the release of the VCR, viewers could now record television programs and watch them at their convenience.

The VCR was a major breakthrough in the television industry. It allowed viewers to watch their favorite shows at any time and even skip through commercials if desired. It also allowed viewers to purchase or rent pre-recorded films, giving them access to films they might not have otherwise seen. The VCR also allowed viewers to time-shift programming, which meant they could record a show that aired in a later time zone and watch it when it was airing in their time zone.

The invention and popularity of the VCR made it possible for viewers to record television programs for later viewing. This technological advancement enabled viewers to watch their favorite shows at any time and paved the way for other advancements in television technology. The VCR was a major breakthrough in the television industry, allowing viewers to watch shows at their convenience and giving them access to films they might not have otherwise seen.

Learn more about VCR (Video Cassette Recorder) at : https://brainly.com/question/13982833

#SPJ4

Coach Carver has created a new team game for his students to play. It involves sprinting, tagging, and throwing a ball. Each team consists of 30 to 40 students. Which place is the safest to play the game?

answer choices
an outdoor basketball court
an empty classroom
a gymnasium
a football field

Answers

Safest place to play a game is d)a football field for sprinting, tagging and throwing a ball.

A football or a soccer field is the most secure spot to play this game since understudies have a field that is 100 yards in length, 54 width, to would anything they like to do in a protected climate. A soccer field has no deterrents, no wholes in the ground, an extraordinary turf surface, and all the space they need to have a great time.

While concocting imaginative and fun games like this, security is the very pinnacle of need and there must be least dangers. Therefore, by the quantity of understudies included and the sort of balls they will utilize, a football field is the best spot to play..

Hence, option d is correct.

To know more about game, visit here:

https://brainly.com/question/13456434

#SPJ4

(Complete question) is:

Coach Carver has created a new team game for his students to play. It involves sprinting, tagging, and throwing a ball. Each team consists of 30 to 40 students. Which place is the safest to play the game? answer choices are

a)an outdoor basketball court

b)an empty classroom

c)a gymnasium

d)a football field

Which of the following statements is true about the transition to parenthood?

a. All mothers are satisfied with their partners' efforts in parenting.
b. Couples agree that babies either bring them closer or move them apart.
c. Research shows that all married couples report an increase in marriage satisfaction after the baby is born.

Answers

Couples agree that babies either bring them closer or move them apart is true about the transition to parenthood.

The transition to parenthood is one of the biggest life changes a person can go through. It can be both exciting and overwhelming. There are a lot of things to learn and juggle, from feeding and diapering to sleep schedules and vaccinations.

But it can also be an incredibly rewarding experience, watching your baby grow and change day by day. Whether you're a first-time parent or adding to your existing family, the transition to parenthood is sure to be a memorable one.

Hence, the correct answer is option "B".

To know more about parenthood, click here.

https://brainly.com/question/20795537

#SPJ4

the law states that a person must be aged 21 or above to drink alcoholic beverages. michael is 19-years-old and he is drinking alcohol. this violation of norms and rules for which punishment is specified by law is called:

Answers

This violation of norms and rules for which punishment is specified by law is called crime.

What does the National Minimum Drinking Age Act of 1984 say, and what happens to people who break it?

According to the National Minimum Drinking Age Act of 1984, the purchase and possession of alcohol by anybody under the age of 21 is forbidden. Fines, driver's license suspension, community service, a necessity to complete alcohol awareness training, and potential jail time are all consequences of infractions.

What do you name a crime's punishment?

Whether it's a contract, a rule, or a regulation, a penalty is the sanction imposed on a person who has broken the law. Civil fines are often less severe than criminal ones, however penalties can be imposed for both types of infractions.

To know more about Drinking Age Act, visit:

brainly.com/question/29738966

#SPJ4

bringing together our issues of critical thinking and social psychology, can you discuss how a resistance to change ones views (and thus fail to think critically) can increase the likelihood that people will be aggressive against those who have done nothing wrong (milgram study)? conform to a group, even when the group is wrong (asch)? or engage in prejudice or cruelty when they have every reason to know their behavior is wrong?

Answers

The trials showed how much one's own opinions are impacted by those of a group.

What can we infer about conformity in groups from the Asch experiments? The trials demonstrated the extent to which an individual's personal opinions are impacted by those of a group.Asch discovered that people would provide a false answer and neglect truth to fit in with the group.(1963), who discovered that subjects in the Asch scenario experienced significantly elevated levels of autonomic arousal.Additionally, this result shows that they were in a conflicting situation, unable to decide whether to disclose what they had seen or to comply to others' expectations.People give succumb to peer pressure because they depend on the group to gratify two crucial needs: the need for a realistic understanding of reality and the need for social acceptance.Because true worldviews frequently result in positive outcomes, people aspire to possess them.

To learn more about Asch experiments refer

https://brainly.com/question/4036719

#SPJ4

A major criticism of humanist theories of personality is that:
a)they are overly pessimistic about human beings.
b)many of the humanist assumptions are untestable.
c)their operational definitions cannot be generalized to everyday life
D).peak experiences occur too frequently to be indicators of self-actualization.

Answers

A major criticism of humanist theories of personality include the following: B) many of the humanist assumptions are untestable.

What is the behaviorist perspective?

In Psychology, the behaviorist perspective can be defined as a theory of psychology which states that the behaviors exhibited by living organisms are learned from the external environment in which they find themselves, rather being innate.

According to the behaviorist perspective, behavior is typically acquired through conditioning and as such, it can be observed without the consideration of thoughts, emotions, "mind," or feelings.

Generally speaking, critics of the humanist theories of personality argue that they are difficult to define operationally, even though the concepts surrounding them are intuitively appealing.

Read more on behaviors here: brainly.com/question/15600167

#SPJ1

How does globalization relate to interdependence?

Answers

Since resources are dispersed unevenly over the world and no country can claim to be fully supplied in terms of all the resources it needs to be completely self-sufficient, globalization and dependency are intimately intertwined.

The term "globalization" describes the growing interconnection and interconnectedness of nations and areas throughout the world. It encompasses an expansion of cross-border trade in commodities, services, and ideas as well as a tightening of financial market integration and a rise in the power of international organizations.

A major factor in the rise in international interconnectedness is globalization. Countries are more dependent on one another for commodities, resources, and economic assistance as a result of their increased trade, financial, and other connections.

To learn more about globalization

https://brainly.com/question/12791954

#SPJ4

Describe steps you could take to develop an effective method for copying san francisco sourdough bread. Assume that you have access to sourdough starter and all the ingredients and equipment you need.

Answers

Answer:

To develop an effective method for copying San Francisco sourdough bread, you could follow these steps:

1. Research the history and traditional methods of making San Francisco sourdough bread. This will give you an understanding of the unique characteristics of this type of bread and how it has been traditionally made.

2. Experiment with different ratios of flour, water, and sourdough starter to find the combination that produces the desired texture and flavor. You may need to adjust the ratios based on the humidity and temperature of your kitchen.

3. Practice shaping and baking the dough to achieve a crispy crust and a soft, chewy interior. You can try different shaping techniques, such as pre-shaping and bench resting, to achieve the desired results.

4. Experiment with different baking temperatures and times to find the combination that produces the best results. You may need to adjust these based on the size and shape of your loaves.

5. Keep detailed notes of your experiments and the results you achieve. This will help you to understand what works and what doesn't and to refine your method over time.

6. Continuously taste and evaluate your bread to ensure that it is consistently meeting your desired standards. Make any necessary adjustments to your method based on your observations and taste test results.

7. Seek feedback from others who have experience making sourdough bread. This can help you to identify areas for improvement and to further refine your method.

By following these steps and being persistent and patient, you should be able to develop an effective method for making San Francisco sourdough bread.

You might use the methods below to create a method for successfully replicating San Francisco sourdough bread:

1. Learn about the origins and age-old techniques of baking San Francisco sourdough bread. This will help you comprehend the special qualities of this kind of bread and how it has historically been created.

2. To find the mixture that yields the desired texture and flavor, experiment with various ratios of flour, water, and sourdough starter. The ratios might need to be changed depending on the humidity and temperature in your kitchen.

3. Experiment with the dough's shaping and baking to get a crisp exterior and a chewy interior. To get the desired results, experiment with various shaping processes like pre-shaping and bench resting.

4. To determine the setting that yields the best results, experiment with various bake times and temperatures. In accordance with the size and form of your loaves, you might need to change these.

5. Take thorough notes on your experiments and the outcomes you obtain. This will assist you in understanding what works and what doesn't so that you may gradually improve your strategy.

6. Constantly sample and assess your bread to make sure it satisfies your intended requirements. Based on your observations and the outcomes of your taste test, modify your procedure as appropriate.

7. Request advice from people who have previous sourdough baking experience. You can use this to find areas for development and improve your approach.

You should be able to build a successful method for baking San Francisco sourdough bread by following these instructions and being persistent and patient.

Learn more about Francisco Visit: brainly.com/question/29806473

#SPJ4

Who was the first African American to escape slavery?

Answers

Harriet Tubman was the first African American to escape slavery. She worked as an equipped spy and informant for the Union Army during the American Civil War.

Harriet Tubman is one of the most well-known fugitive slaves in American history and a leader of the Underground Railroad, a system of antislavery campaigners and safe houses. She worked as an equipped spy and informant for the Union Army during the American Civil War. Later in life, Tubman became active in the fight for women's suffrage. Using force, compulsion, taking advantage of frailty, deception, or other methods, slavery is described as the act of enlisting, transporting, harboring, or receiving individuals with the aim of abuse.

Learn more on antislavery

https://brainly.com/question/29506044

#SPJ4

Other Questions
An item on sale costs %50 of the original price. The original price was 45$.Find the sale price.Please help! I will give the brainiest! 9.5/19=x/30 solve the proportion Where are Gold, Limestone and kaiolin found. PLEASE HELP NO LINKS IM TIMED 1/2 x 1 3/5 to the simplest form Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG Match the words in the left column to the appropriate blanks in the sentences on the right. The secondary structure given in the MaxExpect results can best be described as_________ Thus, the type of RNA is best classified as_________ a single strand with a distinctive cloverleaf structure a single-stranded random coll an unspecified type of RNA rRNA a single strand folded upon itself to form a small, round structure tRNA Find the verbal in the sentence below. Then, Identify the type of verbal.Jane wanted to forget about the matter.-infinitive-participle-gerund Which choice is similar to the figure shown?Please help Im confused on what to do. A physics student of mass 43.0 kg is standing at the edge of the flat roof of a building, 12.0 m above the sidewalk. An unfriendly dog is running across the roof toward her. Next to her is a large wheel mounted on a horizontal axle at its center. The wheel, used to lift objects from the ground to the roof, has a light crank attached to it and a light rope wrapped around it; the free end of the rope hangs over the edge of the roof. The student radius 0.300 m and a moment of inertia of 9.60 kg m^2 for rotation about the axle, how long does it take her to reach the side walk, and how fast will she be moving just beofre she lands? a wave travels one complete cycle in20sec and has wavelength of 1000mm.what is the speed Solve for y:5y+2-2y=8y-4-2y Voluntary migration on culture PLEASE PLEASE HELP IVE BEEN STUCK ON THIS FOR TOO LONG help me please this gives 30 points Describe the steps a plant would take to move sugars from a source to a sink. Which of the following is a check on the power of the judicial branch? aThe president overturns a Supreme Court ruling. bThe House of Representatives impeaches a justice. cThe Senate nominates judges for the Supreme Court. dThe Congress rejects a ruling by the Supreme Court. This OS integrated the processing power of Windows NT with the easy-to-use GUI of Windows 98.Windows Millennium EditionWindows 2000Windows for WorkgroupsWindows 3.11 I was a member of a separatist church that fled first to the Netherlands and then to the New World in search of religious freedom. The men and I signed a document aboard our ship, the Mayflower, that outlined the basics of our self-government. I was governor of the Plymouth Colony until my death. I also wrote a book about the history of our colony. Who am I? Please help me I really need it What percentage of wild fires is started by human behavior?85%90%98%100%ANSWER IS 90%