if abc company raised capital by issuing (selling bonds) where would it appear on the cash flow statement and would cash flow increase or decrease:

Answers

Answer 1

If ABC Company raised capital by issuing bonds, it would appear in the cash flow statement under the financing activities section, and the cash flow would increase.

The cash flow statement is divided into three sections: operating activities, investing activities, and financing activities. When a company issues bonds to raise capital, it falls under financing activities.

This is because the company is obtaining funds from external sources (bondholders) to support its operations and growth. When bonds are issued, the company receives cash from the bondholders, which leads to an increase in cash flow.

In the financing activities section of the cash flow statement, the cash inflow from issuing bonds would be recorded as a positive amount, indicating an increase in cash flow for the company.

To know more about cash flow click on below link:

https://brainly.com/question/30736595#

#SPJ11


Related Questions

incurred manufacturing overhead costs: $ 7 comma 500 in machinery depreciation; paid $ 2 comma 800 for rent and $ 1 comma 290 for utilities (prepare a single compound journal entry.)

Answers

The journal entry to record the incurred manufacturing overhead costs would be:

Debit Manufacturing Overhead $11,590

Credit Accumulated Depreciation $7,500

Credit Rent Expense $2,800

Credit Utilities Expense $1,290

Manufacturing overhead is a broad category that includes all indirect costs associated with the production process. In this case, the company incurred $7,500 in machinery depreciation, $2,800 in rent, and $1,290 in utilities expenses. To record these costs in the accounting system, we need to debit Manufacturing Overhead and credit the relevant expense accounts. Additionally, we need to credit Accumulated Depreciation to account for the decrease in the value of the machinery due to its use over time.

Therefore, the total amount of the journal entry would be $11,590, which is the sum of all the costs incurred.

Journal entries are records of financial transactions flowing in and out of your business. These transactions all get recorded in the company book, called the general journal.

Journal entries are the very first step in the accounting cycle. The main thing you need to know about journal entries in accounting is that they all follow the double-accounting method.

What this means is that for every recorded transaction, two accounts are affected - and as a result, there is always a debit entry and a credit entry.

Before diving into the nits and grits of double-entry bookkeeping and writing journal entries, you should understand why journal entries are so important for a business.

to know more about the manufacturing:

https://brainly.com/question/14275016

#SPJ11

Determine Mr. J's filing status in each of the following independent cases (taxable year is 2016) :
a. Mr. J and Mrs. J were divorced on November 18th. Mr. J has not remarried and has no dependent children.
b. Mr J and the first Mrs. J were divorced on April 2nd. Mr. J remarried the second Mrs. J on December 15th. He has no dependent children.
c. Mrs. J died on July 3rd. Mr. J has not remarried and has no dependent children.
d. Mrs. J died on October 1, 2014. Mr. J has not remarried and maintains a home for one dependent child.
e. Mrs. J died on May 30, 2015. Mr. J has not remarried and has no dependent children.
f. Mr. J and Mrs. J were divorced on May 30, 2013. Mr. J has not remarried and maintains a home for his two dependent children.

Answers

Mr. J's filing status on tax documents will depend on his marital and family status.

Here is the complete Mr. J's filing status for the taxable year 2016 in each of the following independent cases:

a. In this case, Mr. J and Mrs. J were divorced on November 18th. Since Mr. J has not remarried and has no dependent children, his filing status is "Single."

b. Mr. J was divorced from the first Mrs. J on April 2nd and remarried the second Mrs. J on December 15th. Since he is married at the end of the year, his filing status is "Married Filing Jointly" or "Married Filing Separately."

c. Mrs. J died on July 3rd, and Mr. J has not remarried with no dependent children. In the year of the spouse's death, Mr. J's filing status is "Married Filing Jointly" or "Married Filing Separately."

d. Mrs. J died on October 1, 2014, and Mr. J maintains a home for one dependent child. Since he has not remarried, his filing status for 2016 is "Qualifying Widower."

e. Mrs. J died on May 30, 2015, and Mr. J has not remarried with no dependent children. Since more than two years have passed since the spouse's death, his filing status for 2016 is "Single."

f. Mr. J and Mrs. J were divorced on May 30, 2013, and Mr. J maintains a home for his two dependent children. Since he has not remarried, his filing status is "Head of Household."

Based on Mr. J's independent cases above, his status on tax documents will depend on his marital and family status.

To learn more about Filing Status visit:

https://brainly.com/question/30140904

#SPJ11

the goal of government intervention at the macro level is to a. reduce transfer payments and lower taxesb.) achieve full employment and price stability.
c.) increase regulations on businesses to completely eliminate external costs.
d.) encourage greater individual economic independence.

Answers

The correct answer is: b.) achieve full employment and price stability.

Government intervention at the macro level often aims to achieve full employment, which means ensuring that a significant portion of the workforce is employed, and price stability,

What is Government intervention?

Government intervention refers to the involvement of the government in the economy or society through various policies, regulations, and actions aimed at influencing or controlling economic, social, or political activities. Government intervention can take various forms, ranging from direct intervention in specific industries or markets to broader policies and regulations that impact the overall functioning of the economy or society.

Reducing transfer payments and lowering taxes (option a) may be used as fiscal policies to stimulate economic activity, but they are not the overarching goals of government intervention at the macro level.

Learn more about Government intervention from the given link

https://brainly.com/question/29100453

#SPJ1

The correct answer is: b.) achieve full employment and price stability.

Government intervention at the macro level often aims to achieve full employment, which means ensuring that a significant portion of the workforce is employed, and price stability,

What is Government intervention?

Government intervention refers to the involvement of the government in the economy or society through various policies, regulations, and actions aimed at influencing or controlling economic, social, or political activities. Government intervention can take various forms, ranging from direct intervention in specific industries or markets to broader policies and regulations that impact the overall functioning of the economy or society.

Reducing transfer payments and lowering taxes (option a) may be used as fiscal policies to stimulate economic activity, but they are not the overarching goals of government intervention at the macro level.

Learn more about Government intervention from the given link

https://brainly.com/question/29100453

#SPJ1

Customers arrive, with interarrival times distributed as EXPO(5)—all times are in minutes—at a small service center that has two servers, each with a separate queue. The service times are EXPO(9.8) and EXPO(9.4) for Servers 1 and 2, respectively. Arriving customers join the shortest queue. Customer line switching occurs whenever the difference between the queue lengths is 3 minutes or more. At that time, the last customer in the longer queue moves to the end of the shorter queue. No additional movement, or line switching, in that direction occurs for at least the next 30 seconds. Develop a model and animation of this system and run it for 10,000 minutes. Observe statistics on the number of line switches, resource utilization, and queue lengths.

Answers

To run the simulation for 10,000 minutes, we can set the simulation clock to 0 and run the simulation until it reaches 10,000 minutes. We can then analyze the statistics generated by the simulation to gain insights into the system behavior and identify areas for improvement in the manufacturing process.

Based on the given scenario, we can develop a simulation model to observe the system behavior of a small service center with two servers and separate queues. The interarrival times of customers are exponentially distributed with a mean of 5 minutes, while the service times of Servers 1 and 2 are exponentially distributed with means of 9.8 and 9.4 minutes, respectively. Whenever a customer arrives, they join the shortest queue, and line switching occurs whenever the difference between the queue lengths is 3 minutes or more.
To develop the simulation model, we can use a discrete event simulation approach, where we simulate each event that occurs in the system over time. We can start by initializing the system, setting the simulation clock to 0 and generating the first customer arrival time. Then, we can simulate the arrival of each customer and determine which queue they join based on the shortest queue length.
We can also keep track of the queue lengths and the time at which a line switch occurs. When a line switch occurs, we can identify the last customer in the longer queue and move them to the end of the shorter queue. We can also set a timer for at least 30 seconds to prevent additional line switching in that direction.
As the simulation runs, we can observe statistics on the number of line switches, resource utilization, and queue lengths. The number of line switches will depend on the queue dynamics and the arrival and service patterns. The resource utilization will depend on the efficiency of the servers in serving customers. The queue lengths will depend on the arrival rate of customers and the service times of the servers.

Learn more about manufacturing  here:

https://brainly.com/question/14275016

#SPJ11

all of the following are characteristics of mcgregor's theory x except . a. people dislike work and try to avoid it b. people must be led because they have little ambition c. people are concerned mainly with security d. people have the ability to help accomplish an organization's goals e. managers must coerce, control, and threaten employees

Answers

Answer: d. people have the ability to help accomplish an organization's goals

The Denver advertising agency promoting the new Breem dishwashing detergent wants to get the best exposure possbile for the product within the $100,000 advertising budget ceiling placed on it. To do so, the agency needs to decide how much of the budget to spend on each of its two most effective media:(1) television spots during the afternoon hours and (2) large ads in the city's Sunday newspaper. Each tv spot costs $3,000; each Sunday newspaper ad costs $1,250. The expected exposure, based on industry ratings, is 35,000 viewers for each TV commercial and 20,000 readers for each newspaper advertisement. The agency director, Deborah Kellogg, knows from experience that it is important to use both media in order to reach the broadest spectrum of potential Breem customers. She decides that at least 5 but no more than 25 TV spots should be ordered, and that at least 10 newspaper ads should be contracted.How many times should each of the two media be used to obtain maximum exposure while staying within the budget? Use the graphical method to solve.

Answers

The agency should order 5 TV spots and 16 print advertising to gain the most exposure while maintaining within the allocated budget. The graphical method can be used to locate this answer.

In an advertising agency, which division is in charge of the production schedule for advertisements?

The media department is in charge of scheduling the appearance of advertising and purchasing space or time in publications like newspapers, magazines, radio, television, digital media, and outdoor media like billboards and poster sites.

Which among India's largest and oldest advertising agencies?

The first advertising company in India was Dattaram & Company. India's first newspaper is the Bengal Gazette.

To know more about advertising visit:

https://brainly.com/question/16257206

#SPJ1

assuming a medicare tax rate of 1.45 nd weekly gross wages of $4,300, the amount recorded in medicare tax payable for one quarter (13 weeks) for the employee’s payroll deduction is

Answers

The amount recorded in Medicare tax payable for one quarter (13 weeks) for the employee's payroll deduction is $810.55.

Based on the information provided, to calculate the amount recorded in Medicare tax payable for one quarter (13 weeks) for the employee's payroll deduction, you should follow these steps:

1. Multiply the weekly gross wages by the Medicare tax rate: $4,300 * 1.45% (0.0145) = $62.35
2. Multiply the weekly Medicare tax deduction by the number of weeks in a quarter: $62.35 * 13 weeks = $810.55

learn more about Medicare tax here:

https://brainly.com/question/1473508

#SPJ11

What are the four principles regarding healthcare of liberal religious groups? Are we following our principles of liberty, democracy, equity and justice, in our current health care system?

Answers

Liberal religious groups typically prioritize healthcare as a fundamental aspect of ensuring overall health and wellbeing. The four principles that guide their approach to healthcare are liberty, democracy, equity, and justice.

Liberty refers to the belief that individuals should have the freedom to make their own choices about their healthcare. Democracy emphasizes the importance of involving all stakeholders in healthcare decision-making processes. Equity emphasizes the need to ensure that everyone has access to the same level of healthcare, regardless of their socioeconomic status. Justice emphasizes the need to ensure that healthcare is distributed fairly and that everyone has the opportunity to live a healthy life.

In terms of whether we are following these principles in our current healthcare system, it is a mixed bag. While there have been efforts to increase access to healthcare for all individuals, there are still significant disparities in access and quality of care. Additionally, there are ongoing debates about how to balance individual liberties with the need to ensure equitable and just distribution of healthcare resources. Overall, there is still work to be done to fully align our healthcare system with the principles of liberal religious groups.

Learn more about healthcare  here:

https://brainly.com/question/12881855

#SPJ11

an ordinary annuity makes quarterly payments of $1,000. the annuity earns a 12 nnual return with quarterly compounding. the future value of this annuity after 10 quarters is

Answers

The easiest way to solve this problem is to use a financial calculator or spreadsheet function. However, I can provide you with the formula to calculate the future value of an ordinary annuity.

The formula is:

FV = Pmt x [(1 + r)^n - 1] / r

Where FV is the future value, Pmt is the periodic payment, r is the interest rate per period, and n is the number of periods.

In this case, Pmt = $1,000, r = 12% / 4 = 3% per quarter, and n = 10 quarters.

Plugging these values into the formula, we get:

FV = $1,000 x [(1 + 3%)^10 - 1] / 3%
FV = $12,171.49

Therefore, the future value of this annuity after 10 quarters is $12,171.49.

You are an American investor. You face the following prices: S
pot (USD/EUR) 1.09380 1.09400 3-m Forward (USD/EUR) 1.09385 1.09415 Interest rate USD (p.a.) 1.00% 3.00% Interest rate EU (p.a.) 2.00% 4.00% These prices account for the presence of transaction costs in both foreign exchange markets (bid and ask rates) and money markets (borrowing and lending rates). a) Is there an arbitrage opportunity in these quotes? b) If you had to borrow USD 100, where would you borrow? Why? c) If you had to invest USD 100, where would you invest? Why? d) Assume that you require EUR 5000 in three months, what is the smallest amount of USD that you need to put aside today? e) Your great aunt promises to give you EUR 5000 in three months. What is the maximum amount of USD that you can get today?

Answers

a) To check for an arbitrage opportunity, we need to compare the forward exchange rate and the covered interest rate parity (CIRP).
Forward exchange rate = 1.09385 USD/EUR (ask)
Spot exchange rate = 1.09400 USD/EUR (bid)

CIRP = (1 + i_USD) / (1 + i_EUR) * Spot rate
= (1 + 0.01) / (1 + 0.02) * 1.09380
= 1.09347 USD/EUR
Since the forward exchange rate (1.09385) is greater than the CIRP (1.09347), there is no arbitrage opportunity in these quotes.
b) If you had to borrow USD 100, you should borrow at the lowest borrowing rate, which is 1.00% p.a.
c) If you had to invest USD 100, you should invest in the currency with the highest lending rate. In this case, you should exchange your USD to EUR and invest in EU at 4.00% p.a.
d) To calculate the smallest amount of USD needed today to have EUR 5000 in three months, you should use the forward exchange rate:
USD needed = EUR 5000 * Forward rate (bid)
= 5000 * 1.09385
= 5469.25 USD
e) To find the maximum amount of USD you can get today from the promised EUR 5000 in three months, use the spot exchange rate:
USD today = EUR 5000 / Spot rate (ask)
= 5000 / 1.09400
= 4568.55 USD

Learn more about arbitrage here:

https://brainly.com/question/16178885

#SPJ11

To get around the problems of information lag and impact lag, Alan Greenspan led the Fed in using which of these methods for a period of nearly 20 years, and with what results?
a. Greenspan used explicit inflation targeting but met few inflation goals; inflation was relatively high.
b. Greenspan used explicit inflation targeting and met many inflation goals; inflation stayed relatively low and recessions were modest.
c. Greenspan used implicit inflation targeting to stop inflation before it began; inflation was relatively high, nonetheless.
d. Greenspan used implicit inflation targeting to stop inflation before it began; inflation stayed relatively low and recessions were modest.

Answers

Alan Greenspan led the Federal Reserve in using implicit inflation targeting to stop inflation before it began. As a result, inflation stayed relatively low, and recessions were modest during his tenure. The correct option is D.

Implicit inflation targeting is a monetary policy strategy that focuses on maintaining low and stable inflation without explicitly announcing a numerical target. Instead of following a strict rule, the central bank uses a variety of indicators and models to assess inflation risks and adjust monetary policy accordingly. This approach allows for more flexibility and discretion, which can help address issues like information lag and impact lag.

Under Greenspan's leadership, the Federal Reserve successfully managed to keep inflation under control for almost two decades, from 1987 to 2006. During this period, the U.S. economy experienced a prolonged expansion, known as the "Great Moderation," characterized by low inflation, stable economic growth, and modest recessions. This performance has been attributed to the Fed's successful implementation of implicit inflation targeting and its ability to react promptly to changing economic conditions.

In summary, Alan Greenspan's use of implicit inflation targeting at the Fed led to relatively low inflation rates and modest recessions, demonstrating the effectiveness of this approach in addressing information lag and impact lag issues.

To learn more about Federal Reserve refer here:

https://brainly.com/question/23247429

#SPJ11

how would using multiple hard copies of each transaction affect abc's recovery point objective (rpo)?

Answers

Recovery Point Objective (RPO) is the maximum acceptable amount of data loss measured in time, and it represents the point in time to which a system must be recovered after an outage or disaster.

On one hand, having multiple hard  clones of each  sale increases the redundancy and  trustability of ABC's data backupsystem.However, corrupted or destroyed, there are other  clones available that can be used for recovery, If one  dupe of the data is lost. This redundancy can help to reduce the RPO, as the liability of losing all  clones of the data at the same time is much lower.  

On the other hand, using multiple hard  clones can also increase the RPO if the  clones aren't regularly  streamlined or if there are inconsistencies between the copies.However, and the most recent  dupe of the data isn't available,  also the RPO would be set to the last time a complete and accurate  dupe of the data was made, If a disaster or outage occurs. This can affect in a longer RPO and lesser data loss.

Learn more about recovery point objective at

https://brainly.com/question/29577452

#SPJ4

What is more common in business project management today?
a. Activity on Arc (AOA)
b. Activity on Node (AON)
c. Activity on Path (AOP)
d. Activity on Arrow (AOA)

Answers

The correct answer is "Activity on Node (AON)." is more common in business project management today

Activity on Node (AON) is a type of project management technique that is commonly used in business project management today. It is also known as the Precedence Diagram Method (PDM) and is used to model the dependencies between tasks in a project.

In AON, nodes represent the tasks or activities in the project, and arrows represent the dependencies between them. The nodes are arranged in a logical sequence, and the arrows indicate the order in which the tasks should be completed. The length of the arrow represents the duration of the task.

Activity on Arrow (AOA) is an older technique that is not commonly used today. It is similar to AON, but the arrows represent the activities, and the nodes represent the dependencies between them.

Activity on Path (AOP) is not a commonly used project management technique. It is a method of scheduling projects that involves creating a network diagram of the project, and then identifying the critical path, which is the sequence of tasks that must be completed on time in order for the project to be completed on schedule.

Learn more about management  here:

https://brainly.com/question/29023210

#SPJ11

PLEASE HELP ASAPP

PLEASE MAKE THE ANSWER CLEAR EASY TO UNDERSTAND YOU DONT NEED TO EXPLAIN THANK YOU.

Answers

Answer:

health insurance/current total (gross NOT net) and move your decimal over =%

Explanation:

is the hardness of martensitic steel, pearlitic steel, and spheroidized steel the same at equal carbon content? explain in detail why the hardness is the same or different in the three materials.

Answers

No, the hardness of martensitic steel, pearlitic steel, and spheroidized steel is not the same at equal carbon content. The reason for this is that each type of steel undergoes different heat treatments and therefore has a different microstructure, which affects its mechanical properties.

Martensitic steel is known for its high hardness and strength due to its rapid quenching from high temperatures, which results in a highly disordered structure with a high density of defects. Pearlitic steel, on the other hand, is a type of low-alloy steel that is characterized by its fine lamellar structure, consisting of alternating layers of ferrite and cementite. This structure provides good strength and ductility, but it is not as hard as martensitic steel.

Spheroidized steel is a type of heat-treated steel that has been annealed at a high temperature, resulting in a more uniform, spherical structure. This structure provides good ductility and toughness, but it is not as hard as martensitic steel.

Therefore, at equal carbon content, the hardness of these three types of steel will differ due to their different microstructures resulting from their different heat treatments. Martensitic steel will have the highest hardness, followed by pearlitic steel, and then spheroidized steel.

Learn more about carbon here:

https://brainly.com/question/13719781

#SPJ11

when faced with uncertain conditions, it is always best to sign long-term contracts (because they are typically cheaper) and avoid all flexible capacity (because it is more expensive) t/f

Answers

The answer is False, When faced with uncertain conditions, it is not always best to sign long-term contracts because they may not be flexible enough to accommodate changing needs. Flexible capacity may actually be more cost-effective in such situations as it allows for adjustments to be made as necessary.


While long-term contracts may be cheaper in some cases, they are not always the best choice when faced with uncertain conditions. Flexible capacity can provide businesses with the ability to adjust their operations based on changing market conditions, which can be more beneficial in the long run.

In uncertain conditions, it is important to strike a balance between long-term contracts and flexible capacity, depending on the specific needs and circumstances of the business.

To know more about long-term contracts refer here:

https://brainly.com/question/28198040#

#SPJ11

Yan Yan Corp. has a $2,000 par value bond outstanding with a coupon rate of 4.9 percent paid semiannually and 13 years to maturity. The yield to maturity of the bond is 3.8 percent. What is the dollar price of the bond? 1/1/2000 1/1/2013 4.90% Settlement date Maturity date Coupon rate Coupons per year Redemption value (% of par) Yield to maturity Par value 9 100 3.80% 2,000 10 12 13 14 Complete the following analysis. Do not hard code values in your calculations. Leave the "Basis" input blank in the function. You must use the built-in Excel function to answer this question 15 16 17 18 19

Answers

The dollar price of the bond is approximately $2,179.77.

To calculate the dollar price of the bond, we will use the Present Value (PV) of a bond formula:

PV = C * (1 - (1 + r)^(-n)) / r + F * (1 + r)^(-n)

where:
- PV is the present value or price of the bond
- C is the coupon payment (par value * coupon rate / coupons per year)
- r is the yield to maturity per period (yield to maturity / coupons per year)
- n is the total number of periods (years to maturity * coupons per year)
- F is the par value of the bond

Step 1: Calculate C
C = 2000 * 4.9% / 2
C = 49

Step 2: Calculate r
r = 3.8% / 2
r = 0.038 / 2
r = 0.019

Step 3: Calculate n
n = 13 years * 2 (semiannual periods)
n = 26

Step 4: Calculate the present value of the bond
PV = 49 * (1 - (1 + 0.019)^(-26)) / 0.019 + 2000 * (1 + 0.019)^(-26)
PV ≈ 2179.77

The dollar price of the bond is approximately $2,179.77.

To know more about bond refer here:

https://brainly.com/question/17405470#

#SPJ11

What is considered an example of a brand as an identifier for a company or organization?

Answers

Design, term, name, sign, symbol is considered an example of a brand as an identifier for a company or organization.

A brand is a unique identity that represents a company or organization and distinguishes it from its competitors. It can include a name, logo, tagline, design, and other elements that communicate a particular image, personality, or value proposition. A brand helps to establish trust, credibility, and recognition among customers, employees, and stakeholders. It also allows a company or organization to differentiate itself from others in the marketplace and build a loyal following.

For example, Apple's brand is known for its sleek design, innovative technology, and user-friendly experience, while Nike's brand is associated with athleticism, inspiration, and empowerment. A strong brand can contribute to a company or organization's success by creating a positive perception and increasing customer loyalty and retention.

For more about organization:

https://brainly.com/question/16296324

#SPJ11

An HR Professional may escalate, deescalate, or reassign a case _____.

Answers

An HR professional plays a crucial role in managing workplace conflicts and issues. They may escalate, deescalate, or reassign a case depending on the situation and the severity of the issue at hand.

When an HR professional escalates a case, it means they recognize the seriousness of the issue and decide to involve higher-level management or external authorities to resolve the matter effectively.

On the other hand, deescalating a case involves taking steps to reduce the tension or conflict between parties, focusing on resolving the issue internally and maintaining a positive working environment. This might involve mediating conversations, providing training or counseling, and ensuring that both parties feel heard and respected.

Lastly, an HR professional may reassign a case when it is deemed more appropriate for another HR representative or department to handle the situation. This could be due to various reasons such as a conflict of interest, specific expertise required, or workload distribution. In such instances, the case will be transferred to the appropriate personnel to ensure a fair and efficient resolution.

In summary, an HR professional's role involves making crucial decisions on whether to escalate, deescalate, or reassign a case, depending on the specific circumstances and the best course of action for all parties involved.

To learn more about HR representative click here

brainly.com/question/15288893

#SPJ11

Biddle Company uses EVA to evaluate the performance of division managers. For the Wallace Division, after-tax divisional income was $465,000 in year 3. The company adjusts the after-tax income for advertising expenses. First, it adds the annual advertising expenses back to after-tax divisional income. Second, the company managers believe that advertising has a three-year positive effect on the sale of the company's products, so it amortizes advertising over three years.
Advertising expenses in year 1 will be expensed 53 percent, 34 percent in year 2, and 13 percent in year 3.
Advertising expenses in year 2 will be expensed 53 percent, 34 percent in year 3, and 13 percent in year 4.
Advertising expenses in year 3 will be amortized 53 percent, 34 percent in year 4, and 13 percent in year 5.
Third, unamortized advertising expenses become part of the divisional investment in the EVA calculations. Wallace Division had incurred advertising expenses of $126,000 in year 1 and $226,000 in year 2. It incurred $266,000 of advertising in year 3.
Before considering the unamortized advertising, the Wallace Division had total assets of $4,265,000 and current liabilities of $613,000 at the beginning of year 3. Biddle Company calculates EVA using the divisional investment at the beginning of the year. The company uses a 13.3 percent cost of capital to compute EVA.
Required: Compute the EVA for the Wallace Division for year 3. (Negative amount should be indicated by a minus sign. Round your final answer to the nearest dollar amount.)

Answers

EVA is a more true depiction of the company's performance, hence I would advise adopting it as the performance indicator. Because the 4-year EVA advertising campaign's long-term advantages are taken into account, the EVA estimate is more precise.

Residual income equals (Operating Income - Cost of Capital x Invested Capital)

= ($129,400) - ($630,000 - (0.06 x 5,690,000)

EVA equals (Operating Income - Cost of Capital x Adjusted Invested Capital)

= (630,000 - 0.06 x (5,690,000 - (70,000/4)

= $89,400 There is a difference between the solutions to requirements 1 and 2 in that the residual income calculation does not account for advertising costs, whereas the EVA calculation does. ROl clothing=(After-tax operating income from sales/invested assets)*A100 ROI clothing

=($1,600,000/$8,,000,000)"A100 ROl clothing=20% ROl cosmetics

=($1,200,000/$4,800.000)A100 ROl Cosmetics

=25% To calculate the residual income, we must use the following formula: ROl clothing=($1,200,000/$4,800.000)A100 ROl Cosmetics=25%.

To know more about EVA visit:

https://brainly.com/question/30027708

#SPJ4

in the case of the johnson report, the report findings were unsubstantiated. "in the case of" and "the report" "the report findings" "johnson report" and "unsubstantiated"

Answers

In the case of the Johnson Report, the findings of the report were deemed unsubstantiated. The report, which was commissioned to investigate claims of fraud within a particular company, was unable to find concrete evidence to support the allegations.

Despite the lack of evidence, the report still had significant implications for the company and those involved. The fact that the findings were unsubstantiated means that the report did not have the same level of authority and credibility as it would have if the allegations had been proven. This can be frustrating for those who were hoping for a clear resolution to the situation, but it is also a reminder of the importance of thorough investigations and evidence-based decision-making.

While the Johnson Report may not have provided a definitive answer, it did serve as a cautionary tale about the potential consequences of unethical behavior in the business world.

You can learn more about concrete evidence at: brainly.com/question/9911419

#SPJ11

his activity is important because firms must communicate with customers for marketing to occur. Marketing mangers use one or more of the five promotional elements to communicate with customers: advertising, personal selling, public relations, sales promotion, and direct marketing. The goal of this activity is to demonstrate your understanding of the differences between the five promotional elements. For each description, select the appropriate category. 1. McDonald's Monopoly-Game that the hamburger chain runs periodically (Click to select) 2. Blue suits/white shirts-Uniform of IBM personnel calling on customers (Click to select) 3. Bombas socks-With the tagline "Bombas socks will knock your old socks right off," Bombas uses Time magazine as its channel of communication. (Click to select) 4. Going green-The newspaper runs a special interest story about how a local business is becoming more environmentally friendly. (Click to select) 5. Buy one/get one free-Joseph A. Bank's deal of the day on suits (Click to select) 6. Mr. Plaid Coat-When you walk into the car dealership, an employee greets you and begins asking questions about your automobile needs. (Click to select) 7. L.L.Bean Catalog-The catalog for outdoor gear, apparel and footwear that is delivered to your home (Click to select) 8. Spam-Those obnoxious emails that come in trying to sell you something (Click to select) 9 Company Annual Report-Sent to all shareholders tells how wonderful the company is10. Allstate Mayhem-Allstate insi featured in its television commercials (Click to select)

Answers

Mayhem may take many different forms, even while watching the new March Madness advertisement from Allstate while shooting hoops in the driveway at home.Mayhem, a fictional character, is shown breaking in the 30-second TV ad. Dean Winters, an actor, portrays the title role in an advertisement for Allstate.

Who is the voice talent for the Allstate Mayhem ads?

A native of the United States, Dean Gerard Winters was born on July 20, 1964. He is well-known for playing Ryan O'Reily on the HBO prison drama Oz. He has also appeared in episodes of Rescue Me, 30 Rock, Sex and the City, Law & Order: Special Victims Unit, and portrayed "Mayhem" in a number of Allstate Insurance commercials.

Which advertisement debuted before Mayhem?

Mayhem, the fictional character portrayed by actor Dean Cain, was initially presented by Allstate in 2010.

To know more about Allstate visit:-

https://brainly.com/question/31445165

#SPJ1

todd's trust fund pays $500 a month for the next 30 years. the current value of these payments is called: simple amount. compounded value. future value. present value. single amount.

Answers

The current value of Todd's trust fund payments is called the present value. This represents the value of the payments in today's dollars, taking into account inflation and the time value of money.

The future value would be the amount that the payments would grow to over the 30-year period if they were invested and earned interest. The compounded value would refer to the future value if the payments were compounded at a certain rate of interest. The simple amount and single amount are not applicable in this scenario. So, the current value of Todd's trust fund payments is called the present value.

Learn more about payments here:

https://brainly.com/question/15136793

#SPJ11

a company has net income of $475,000, net sales of $10,400,000, and average total assets of $5,462,500. its return on total assets equals:equals:23.22%.
a. 44.53%.
b. 10.34%.
c. 4.31%.
d. 430.66%.

Answers

The return on total assets (ROTA) is calculated by dividing net income by average total assets, then multiplying the result by 100 to get a percentage. The Correct option is C

The return on total assets (ROTA) is calculated as follows:

ROTA = (Net Income / Average Total Assets) x 100%

Plugging in the given values, we get:

ROTA = ($475,000 / $5,462,500) x 100%

ROTA = 0.0869 x 100%

ROTA = 8.69%

Therefore, the company's return on total assets is 8.69%. This means that for every dollar of average total assets owned by the company, it generates a profit of $0.0869. This ROTA of 8.69% is considered a decent performance as it indicates that the company is effectively utilizing its assets to generate profits.

Learn more about assets

https://brainly.com/question/15000262

#SPJ4

Calculate the Cross-Price Elasticity of the following goods and say whether they are compliment's or substitutes.A. When there is a 20% decrease in the quantity of peanut butter when the price of jelly increased by 40%.B. When there was a drop in the quantity demanded of Samsung phones from 600,000 to 400,000 when apple decreased the price of the Iphone from $199 to $99.

Answers

A. The cross-price elasticity is negative, we know that peanut butter and jelly are complements. This means that as the price of jelly goes up, the demand for peanut butter goes down.

B. The cross-price elasticity is negative, we know that Samsung phones and iPhones are substitutes. This means that as the price of iPhones goes down, the demand for Samsung phones goes down as well.

A. To calculate the cross-price elasticity, we use the formula:

Cross-Price Elasticity = (% Change in Quantity of Good A)/(% Change in Price of Good B)

In this case, we have a 20% decrease in the quantity of peanut butter and a 40% increase in the price of jelly. Plugging these values into the formula, we get:

Cross-Price Elasticity = (-20%)/(+40%) = -0.5

Since the cross-price elasticity is negative, we know that peanut butter and jelly are complements. This means that as the price of jelly goes up, the demand for peanut butter goes down.

B. Using the same formula as above, we have:

Cross-Price Elasticity = (% Change in Quantity of Good A)/(% Change in Price of Good B)

In this case, we have a 33.3% decrease in the quantity demanded of Samsung phones (from 600,000 to 400,000) and a 50% decrease in the price of the iPhone (from $199 to $99). Plugging these values into the formula, we get:

Cross-Price Elasticity = (-33.3%)/(+50%) = -0.67

Since the cross-price elasticity is negative, we know that Samsung phones and iPhones are substitutes. This means that as the price of iPhones goes down, the demand for Samsung phones goes down as well.

Learn more about elasticity here

https://brainly.com/question/28790459

#SPJ11

As a leader, you want to show concern for your subordinates' needs. According to the path-goal theory, what type of leadership should you use?
A.Participative leadership
B.Achievement-oriented leadership
C.Supportive leadership
D.Directive leadership

Answers

According to the path-goal theory, the type of leadership that a leader should use to show concern for their subordinates' needs is supportive leadership. The correct option is c.

This type of leadership is focused on creating a positive and friendly work environment where the leader is approachable and provides emotional support to their team. Supportive leaders are also committed to their subordinates' personal development and well-being, providing guidance and resources to help them achieve their goals.

This leadership style is particularly effective when subordinates are facing difficult tasks or working under high levels of stress, as it helps to alleviate anxiety and create a sense of camaraderie among team members.

For more such questions on path-goal theory , click on:

https://brainly.com/question/24163366

#SPJ11

Carla Vista Company uses a periodic inventory system. For April, when the company sold 550 units, the following information is available.
Units Unit Cost Total Cost
April 1 inventory 300 $19 $5,700
April 15 purchase 410 23 9,430
April 23 purchase 290 25 7,250
1,000 $22,380
Compute the April 30 inventory and the April cost of goods sold using the FIFO method.

Answers

According to the accounting principle known as first in, first out (FIFO), assets that are bought or acquired first are also the first to be sold. According to FIFO, the inventory still on hand is made up of products that were bought last.

To compute the April 30 inventory and the April cost of goods sold using the FIFO (First-In, First-Out) method, follow these steps:

1. Determine the total units sold and available for sale:
  Sold: 550 units
  Available for sale: 1,000 units (300 + 410 + 290)

2. Apply the FIFO method to find the cost of goods sold:
  a. Sell 300 units from the April 1 inventory at $19 each: 300 * $19 = $5,700
  b. Sell 250 units from the April 15 purchase at $23 each: 250 * $23 = $5,750
  (300 + 250 = 550 units sold)
April cost of goods sold (COGS) = $5,700 + $5,750 = $11,450

3. Compute the remaining inventory:
  a. 160 units remaining from the April 15 purchase at $23 each: 160 * $23 = $3,680
  b. All 290 units from the April 23 purchase at $25 each: 290 * $25 = $7,250
April 30 inventory = $3,680 + $7,250 = $10,930


In summary, using the FIFO method, Carla Vista Company's April 30 inventory is $10,930, and the April cost of goods sold is $11,450.

To know more about inventory visit : https://brainly.com/question/14184995

#SPJ11

a. Given the following:Ca = $120,Ig = $60,Xn = − $10, andG = $40,What is the economy’s equilibrium GDP?Instructions: Enter your answer as a whole number.Equilibrium GDP = $ .

Answers

To determine the economy's equilibrium GDP, we need to use the formula:

Y = C + I + G + Xn

where Y represents GDP,

C is consumption,

I is investment,

G is government spending, and

Xn is net exports.

Given the values, we can substitute them into the formula:

Y = $120 + $60 + $40 - $10

  = $210.

Therefore, the economy's equilibrium GDP is $210.

The equilibrium GDP is the level of output where aggregate demand equals aggregate supply. At this level, the economy is in a state of balance, and there is no tendency for it to move away from this level.

In other words, the economy is producing the optimal level of goods and services that consumers are willing to buy, and firms are willing to supply.

The factors that determine equilibrium GDP are consumer spending, investment spending, government spending, and net exports. Changes in any of these factors can shift the equilibrium GDP.

For instance, if there is an increase in consumer spending, it will lead to a rise in GDP. Similarly, if there is a decrease in government spending, it will lead to a decline in GDP.

In conclusion, the economy's equilibrium GDP is $210, based on the given values. It is the level of output where aggregate demand equals aggregate supply, and it represents the optimal level of goods and services produced in the economy.

To know more about GDP refer here

brainly.com/question/29763310#

#SPJ11

n the absence of trade, total surplus in the guatemalan coffee market amounts to

Answers

In the absence of trade, the total surplus in the Guatemalan coffee market amounts to the sum of consumer surplus and producer surplus.

Consumer surplus is the difference between the price consumers are willing to pay and the actual price they pay, while producer surplus is the difference between the price producers receive and their production cost.

In a closed market without trade, these surpluses are determined by the intersection of the local supply and demand curves.

The total surplus in the Guatemalan coffee market is the sum of consumer surplus and producer surplus, as it represents the overall economic welfare or benefit derived from the coffee market.

The local supply and demand curves intersect at a point where the quantity of coffee supplied matches the quantity of coffee demanded, and this determines the equilibrium price and quantity in a closed market without trade.

It's important to note that the presence of trade, such as international trade in coffee, can affect the total surplus in the market as it can change the equilibrium price and quantity, and consequently impact consumer surplus and producer surplus.

Trade can lead to gains from trade, where both consumers and producers can benefit, or it can also lead to losses if it negatively affects domestic producers.

Understanding the concepts of consumer surplus, producer surplus, and how they are determined by supply and demand curves can help in analyzing the effects of trade on market outcomes.

To learn more about producer surplus, refer below:

https://brainly.com/question/15416023

#SPJ11

using what you have learned so far about rethinking it as an investment portfolio develop an ‘value analysis’ template that you could use in a discussion with the cfo to help quantify it value.

Answers

For a value analysis template that can be used to quantify the value of an IT investment portfolio in a discussion with the CFO. Here's a sample template:
Value Analysis Template
Business objectives
IT investments
Risk assessment
Portfolio analysis

IT investment portfolio refers to a collection of investments in IT assets, projects, and initiatives that are intended to support an organization's business objectives. The portfolio can be viewed as an investment portfolio, where each IT investment is evaluated based on its cost, risk, and potential return. Value analysis is a process that evaluates the value generated by IT investments and helps decision-makers make informed investment decisions. A value analysis template can provide a structured approach to analyzing the value of the IT investment portfolio and can be used to guide discussions with the CFO or other stakeholders. The template above includes key elements such as business objectives, IT investments, risk assessment, alignment with business objectives, portfolio analysis, and recommendations.

Learn more about investment portfolio here:

https://brainly.com/question/31130247

#SPJ11

Other Questions
What happens to the cous cous when the boiling water is added? The five girls had their refreshments at thekitchen table, and it was while Rosie wasshowing the sisters her trick of swallowing peachslices without chewing (she chased each slippery crescent down with a swig of tea) that her father brought his empty teacup and untouched saucerto the sink and said, "Come on, Rosie, we'regoing home now.""Already?" asked Rosie."Work tomorrow," he said.He sounded irritated, and Rosie, puzzled, gulped one last yellow slice and stood up to go, whilethe sisters began protesting, as was their wont."We have to get up at five-thirty," he told them, going into the front room quickly, so that theydid not have their usual chance to hang onto his hands and plead for an extension of time.Seventeen Syllables,Hisaye YamamotoRead the excerpt. What is the conflict in this scene?Rosie wants to swallow peach slices whole, but her father does not approve of this.Rosies father wants his family to leave, while the Hayano sisters want them to stay.Rosies father wants her to go to work early tomorrow, while Rosie wants to go later.Rosie wants to leave, but the Hayano sisters want to watch her swallow peach slices. IRAC: Two colleagues decide to incorporate their Internet social networking business. They want complete control of the business, yet they need additional capital to expand the business. The two colleagues enter negotiations with eight friends willing to provide capital to the corporation. The friends agree that they will not be allowed to elect directions, but they want to make sure that they will receive a return on their investments by receiving payments from the corporation quarterly or semiannually. What securities with what rights should the corporation create to achieve the objectives of the friends and colleagues? For each security you create, sketch the rights of the holders. 3. what is the spring constant? k = 0.49 incorrect: your answer is incorrect. n/cm 4. what is the force of the spring 2 Aggregate production strategies are part of your _______________ planning.a. Long rangeb. Short rangec. Intermediate range Mammals have fur, they suckle their young and the young develop inside the mother. is it True or False decribe teh mechansims resonpitble for con-a induced hemagglucnation reaction answer fast pls Translate these descriptions into a numerical expression:Find the sum of 2 and 4, then multiply by 7.Divide 12 by 3, then multiply by 5 In the first stage of photosynthesis, light energy is converted into chemical energy and reducing equivalents (NADPH + H+). This phenomenon is called A) energy transduction B) decay c) radiation D) kinetic energy E) potential energy 16.5 ft tall giraffe casts a 12-ft. shadow. at the same time a zookeeper casts a 4-ft shadow how tall in feet is the zookeeper how many grams of na2co3 (fm 105.99) should be mixed with 5.00 g of nahco3 (fm 84.01) to produce 100 ml of buffer with ph 10.00? After plotting the voltage waveform, obtain a 0.2-mp expressions and generate plots for (t), p (t), and w (t) for i by capacitor. The voltage waveforms are given:(a) v_1(t) = 5r(t) - 5r(t 2) V (b) v_2(t) = 10u(-t) + 10u(t) - 5r(t-2) + 5r(t-4) V (c) v_3(t) = 15u(-t) + 15e^(-0.5t) u(t) V (d) v_4(t) = 150[1 - e^(-0.5t)] u(t) V angles of a triangle Are dichotomous keys purely a human invention? Explain. in galatians, paul uses ___________ as an example of one justified by faith. It is recommended to interview the HIS users to identify vital information to daily operation in contingency planning True False Which network topology is the most reliable and why?OA. Ring topology, because data flows in one direction from node tonode around the ringB. Star topology, because the server manages all network traffic inone location, making it convenientC. Bus topology, because on large networks it is easy to fix if a cablefails and all nodes lose connectionD. Fully connected mesh topology, because it provides a connectionfrom each node to every other node in the network A rule that CANNOT be violated by database users is called a:(A) password.(B) program.(C) constraint.(D) view. Which of the following variables of an asteroid collision affects the impact crater they leave behind?O SizeO SpeedO MassO All of the above 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose?