Answer:
Red blood cells haveadaptations that make them suitable for this: they contain haemoglobin - ared protein that combines with oxygen. they have no nucleus so they can contain more haemoglobin. they are small and flexible so that they can fit through narrow blood vessels.
Explanation:
Hope It Helps
Once mRNA is made it travels
A. out of the cytoplasm, into the nucleus where a ribosome will attach to it.
B. out of the nucleus, into the cytoplasm where a ribosome will attach to it.
Answer:
B. out of the nucleus, into the cytoplasm where a ribosome will attach to it.
Explanation:
Once mRNA is made, it travels out of the nucleus, into the cytoplasm where a ribosome will attach to it.
Which of the following is NOT an example of natural selection? *
A. Plants with thorns are less likely to be eaten by herbivores than other members of the same species that lack thorns.
B. Bacterial populations in hospitals develop resistance to drugs used to combat infection by them.
C. Scientists breed cows that give greater amounts of milk than their ancestors.
D. Fruit fly larvae with an enzyme to break down alcohol are better able to feed on fermenting fruit than those that lack the enzyme.
E. Female fish that produce more eggs leave more offspring than those that produce fewer eggs.
Answer:
The Answer is C
Explanation:
When scientists breed cows to produce more milk, this has not occured naturally and thus is not natural selection.
Answer:
C. Scientists breed cows that give greater amounts of milk than their ancestors.
Explanation:
The scientists breed cows that give greater amounts of milk than their ancestors is not an example of natural selection. So, option (C) is correct.
Which sample formed from the solidification of lava near Earth's surface
How has the human population grown in the last 200 years? Why has human population growth accelerated in the last 200 years?
Answer:
1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world. 2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet.
Explanation:
Answer:
1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world. 2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet
Explanation:
Homologous structures, or shared detailed structures, shows us that we are _____.
A. unrelated organisms
B. bacteria
C. aliens
D. related
Answer:
Hi, there the answer is D. related
Explanation:
Homologous structures are similar structures in related organisms.
Hope This Helps :)
Answer:
it is d i think
Explanation:
what is photo synthesis?
Answer:
The process autotrophs (plants) use to create food. they convert CO2 (Carbon Dioxide) and H2O (Water) into O2 (Oxygen) and glucose (sugar).
Answer:
photo synthesis is the green plants which making other organisms to convert engry into chemical
A 9.0 is how many times more powerful than a
4.0 on the Richter scale?
Answer:
It increases 31.7 times between whole number
values.
Explanation:
"That is, the wave amplitude in a level 6 earthquake is 10 times greater than in a level 5 earthquake, and the amplitude increases 100 times between a level 7 earthquake and a level 9 earthquake."
Which process comes first in the process of protein synthesis?
A. Transcription
B. Translation
Answer:
A. Transcription
Explanation:
Transcription comes first in the process of protein synthesis.
Answer:
A.Transcription
Explanation:
Transcription is the process of making an RNA copy of a gene sequence. This copy, called a messenger RNA (mRNA) molecule, leaves the cell nucleus and enters the cytoplasm, where it directs the synthesis of the protein, which it encodes.
1. Osmosis and diffusion are same phenomena.
Answer:
they are not the same thing. Osmosis is only for water molecules. i found this, hope it is useful,'Osmosis happens when molecules move from higher to lower concentrations, but diffusion happens when it is reversed'
Explanation:
Answer:
Explanation:
Not the same
Which organism, roadrunner or the owl, competes more for its food?
Support your answer with evidence from the food web.
The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.
What do you mean by predators ?
Predators are animals that hunt, kill, and consume other animals (known as prey) for their sustenance. Predation is a common form of interaction between different species in many ecosystems. Predators come in many different forms, such as mammals, birds, fish, insects, and reptiles.
Predators are typically characterized by certain physical and behavioral adaptations that help them hunt and capture prey. For example, many predators have sharp teeth, claws, or beaks that are used to kill and consume their prey. Others may have specialized hunting techniques or strategies that make them highly effective predators.
The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.
Roadrunners are known to be opportunistic hunters and can feed on a wide range of prey items. They are ground-dwelling birds and use their speed and agility to catch their prey. Roadrunners are also known to eat eggs and young of other birds, including owls.
Owls, on the other hand, are nocturnal predators that are known for their exceptional hearing and vision, which enables them to hunt in low light conditions. They are also skilled hunters and can catch a variety of prey, including rodents, small mammals, and birds.
Therefore, both roadrunners and owls are capable of competing for food, but the level of competition depends on the availability of prey, habitat, and other factors. In general, the competition between these two species is likely to be limited, as roadrunners are diurnal (active during the day) and owls are nocturnal (active at night).
Learn more about predators click here:
https://brainly.com/question/29779690
#SPJ1
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Answer:
- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
helpp mee pleaseeee need help
Answer: it will increase the frequency of the action potential hope this helps
Explanation:
When the homologous chromosomes align at the equator and then separate during meiosis I, they do so randomly. This event supports Mendel’s Law of
Which of the following is a subsystem of an organism?
What is anatomy?
Simple answer please!
I'll give brainlist
Answer:
Anatomy is the study of the bodies of people and other animals
hope this helps
have a good day :)
Explanation:
Anatomy is the branch of biology concerned with the study of the structure of organisms and their parts. Anatomy is a branch of natural science which deals with the structural organization of living things. It is an old science, having its beginnings in prehistoric times.
Which equation summarizes the process of respiration
Explanation:
i hope this helps you ok like
DNA acts as a _____________ for living things
A. map
B. blueprint
Answer:
A. map
Explanation:
DNA acts as a map for living things.
what do you mean by mental labour
Answer: Mental Labour, According to this definition, mental work refers to planning, organizing, coordinating, and managing duties and tasks that we perform during the course of our lives. People's worries about their ability to manage their time efficiently and effectively.
Explanation:
I explained at the top-
Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts
Answer:
Name one waste substance the coronary veins will remove.
…………………………………………………………………………………………………..……………………
Identify the main floral organs
of a flower.
Fossils show that some of those extinct organisms evolved into organisms that survived today like _____.
A. ants
B. humans
C. wolves
D. birds
Answer:
c wolves would be your Excellent answer
Answer:
D. birds
Explanation:
Fossils show that some of those extinct organisms evolved into organisms that survived today like birds.
2. The formation of male and female sex cells is known as
A) gametogenesis
B) budding
C) sporulation
D) regeneration
Answer:
A . the formation of male and female sex cell is known as gametogenesis
The similarity of the structures shown in the picture suggests that the organisms_______
1) have a common ancestor
2) all grew at different rates
3) live for a long time
4) evolved slowly
¿A que evidencia de la evolucion hacen referencia los arboles evolutivos? A.Embriologia B.Regristro fosil C.Distribucion geografica D.Grupos taxonomicos E.Anatomia comparada
Answer:
D.Grupos taxonomicos
Explanation:
Un árbol evolutivo muestra la relación entre los organismos biológicos a medida que evolucionan a partir de un ancestro común.
Los árboles evolutivos indican que las especies a menudo comparten un ancestro común.
El árbol evolutivo muestra la relación entre los grupos taxonómicos a medida que avanza el proceso de evolución.
What is the function of the Sebaceous Gland * To produce Sweat
To produce water
To produce natural oils for the skin protection None of the Above
Answer:
To produce natural oils for the skin
Explanation:
The normal function of sebaceous glands is to produce and secrete sebum, a group of complex oils including triglycerides and fatty acid breakdown products, wax esters, squalene, cholesterol esters and cholesterol.
Sebum lubricates the skin to protect against friction and makes it more impervious to moisture
5.
Name three factors that may affect the carrying capacity of the population. (3 points)
Please help me with this
Answer:
bro ineed help to
Explanation:
Answer:
option 1 is the crt answer
Explanation:
B and j show more dna similarity as B is the direct ancestor of j
In 2012, excitement rippled through the scientific community with the discovery of an enzyme that appeared to be, just maybe, a powerful new tool for combating Alzheimer’s. At the Mayo Clinic in Florida researchers identified a gene, BACE2, which appeared to destroy beta-amyloid — a protein, then understood to be toxic, which is found in clusters in the brains of people living with Alzheimer’s. Alzheimer's is often diagnosed by measuring the amount of buildup of this protein. A large amount of it is an indicator of the disease. People with this buildup often do not have enough of the BACE2 enzyme created naturally in their body. If a way to synthesize this enzyme artificially or to prompt the body to create more were discovered, it could be hailed as a cure for Alzheimer's. How does the BACE2 enzyme work?
Answer:
BACE2 cuts both beta-amyloid and beta-amyloid precursor protein.
Explanation:
What makes BACE2 so effective in fighting Alzheimer's is its efficiency in cutting both beta-amyloid and the protein that develops it. There are other enzymes, which have the ability to break down beta-amyloid, but BACE2 is the only one that breaks it down into such small pieces that it completely destroys it. Furthermore, BACE2 is able to break down the beta-amyloid precursor protein, which prevents the formation of beta-amyloid from taking place.
Which organism in the food web below is likely to store the most energy?
boa constrictor
beetle
coati
poison dart frog
sloth
strangler fig
fungus
fruit bat
A. Strangler fig
B. Boa constrictor
C. Beetle
D. Poison dart frog
Answer:
Beatle
Explanation:
Beetle in the food web below is likely to store the most energy. So, the correct option is (C).
What is Food Web?A food web is defined as the natural interconnection of food chains and is a graphical representation of what-eats in an ecological community. Food web is also known as consumer-resource system.
A food web consists of many food chains while a food chain follows only one path as animals find food. For example, Falcon eats snake, which has eaten frog, which has eaten grasshopper, which has eaten grass. Thi shows the many different pathways that plants and animals are connected.
In this, the lower trophic level organisms have more energy than the upper trophic level because only 10% of the energy flows from one trophic level to the next. In the above case, beetles have the highest energy compared to other organisms.
Thus, Beetle in the food web below is likely to store the most energy. So, the correct option is (C).
Learn more about Food Web, here:
https://brainly.com/question/18816028
#SPJ2
sources of potassium for plants
Answer:
mined rock powders and wood ash.
Explanation: