Here is a rectangle ABCD.
20 cm
30 cm
The length of the rectangle is increased by 20%.
The width of the rectangle is increased by 10%.
Find the percentage increase in the area of the rectangle.
12​

Here Is A Rectangle ABCD.20 Cm30 CmThe Length Of The Rectangle Is Increased By 20%.The Width Of The Rectangle

Answers

Answer 1

Answer:

32%

Step-by-step explanation:

Area of rectangle ABCD = 20 * 30 = 600 Sq cm

After increasing the length and width of the rectangle by 20% and 10% respectively.

New length = 30 + 20% of 30 = 30 + 6 = 36 cm

New width = 20 + 10% of 20 = 20 + 2 = 22 cm

Area of new rectangle = 36*22 = 792 Sq cm

Increase in area = 792 - 600 = 192 Sq cm

Percentage increase in area

= (192/600) *100

= 32%

Answer 2

Answer:

nnnnnnnfjnjzfv

Step-by-step explanation:


Related Questions

brainliest for best answer

Answers

Answer:

1/2 and 6/1

i belive you cross multiply

so you would get 12/1

so n=12

hopw i helped

Step-by-step explanation:

Are the two ratios equivitant? Explain your reasoning. The ratios of boys to girls is 5 to 2. The ratio of girls to boys is 2:5​

Answers

Answer:

Yes

Step-by-step explanation:

The order is switched from boys to girls(5 to 2)to girls to boys (2 to 5).

The chemical acidity of a solution is measured in units of pH: pH=-log[H+], where [H+] is the hydrogen ion concentration in the solution. What is [H+] if the pH=8.8?

Answers

Answer:

3.5

Step-by-step explanation:

The chemical acidity of a solution is measured in units of pH: pH=-log[H+], where [H+] is the hydrogen ion concentration in the solution. 1.58 x 10⁻⁹ is [H+] if the pH=8.8.

What do you mean by pH ?

The term pH is defined as the negative logarithm of the [H+] hydrogen ion.

The isolated hydrogen ion, represented by the symbol H+, hence it is used to represent a proton. Because the bare nucleus can readily combine with other particles like electrons, atoms, and molecules, the  hydrogen ion.

The formula for calculating [H+] hydrogen ion is as follows:

pH = - log[H+]

Given pH = 8.8

8.8 = - log[H+]

-8.8 =  log[H+]

Taking Antilogarithm Both side

Antilog of [-8.8] = [H ]

By solving above expression [H+]

= 1.58 x 10⁻⁹

Thus, 1.58 x 10⁻⁹ is [H+] if the pH=8.8.

To learn more about the pH, follow the link;

https://brainly.com/question/15289741

#SPJ2

Take your time with this. Just try to help me with this.

Answers

Answer:

A.

The y intercept is at 0,550 for the city of Everett. That means that initially the city started out with 550 Chromebooks.

B. y = 50x + 300

Step-by-step explanation:

A.

The y intercept is at 0,550 for the city of Everett. That means that initially the city started out with 550 Chromebooks.

For all the years after is when the line graph goes up which means they are adding to their total number.

B.   For the city of Revere, they started out with 300 and are adding 50 Chromebooks every year.

Y represents the total and x is each counting year.

So the equation of the line is represented by y = mx + b

b is any constant which in this case is any initial amount (300)

and m is the rate/change which is the number represented by the value that will go up ever year of x (50)

So plug it all in equals:

y = 50x + 300

An online service charges $3 for each downloaded movie, plus a monthly fee of $6,50 Which function represents this
situation?
OY=3x6.50
OY"65073
Oy 3x6.50
OY=650x3



I need bad help.

Answers

Answer:

ANSWER

y = 3x + 6.50

EXPLANATION

The $3 for each downloaded movie is the unit rate of change.

This is represent the slope of the linear function that models this situation.

The monthly fee of monthly fee of $6.50 the constant rate.

It represents the y-intercept of the function.

The linear function is given by

y = mx + by=mx+b

The correct choice is y = 3x + 6.50

Answer:

A. Y= 3x6.50

Step-by-step explanation: This is the correct answer, because you can use the process of elimination on answers B and C due to how they are set up. And D is incorrect, because there is no decimal in 650 which is not the correct number in the problem. Therefore, A. Y= $3 for each downloaded movie multiplied by the monthly fee of $6.50 is the correct answer. Hope this helps ^-^.

What is the answer to this problem step by step (3+2)^2×7)-13+5^2?

Answers

Answer:

187

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Step-by-step explanation:

Step 1: Define

(3 + 2)² × 7 - 13 + 5²

Step 2: Evaluate

(Parenthesis) Add:                     5² × 7 - 13 + 5²Exponents:                                 25 × 7 - 13 + 25Multiply:                                      175 - 13 + 25Subtract:                                     162 + 25Add:                                            187

Alright people..guess the lyrics if u don't get it right your not an arianator :)

"Somethin' 'bout you makes me feel like a dangerous woman"

Answers

something bout, something bout you, makes me wanna do things that i shouldnt

Don't need permission

Made my decision to test my limits

Cause it's my business, God as my witness

Start what I finished

Don't need no hold up

Taking control of this kind of moment

I'm locked and loaded

Completely focused, my mind is open

All that you got, skin to skin, oh my God

Don't ya stop, boy

Somethin' 'bout you makes me feel like a dangerous woman

Somethin' 'bout, somethin' 'bout, somethin' 'bout you

Makes me wanna do things that I shouldn't

Somethin' 'bout, somethin' 'bout, somethin' 'bout

Nothing to prove and I'm bulletproof and

Know what I'm doing

The way we're movin' like introducing

Us to a new thing

I wanna savor, save it for later

The taste of flavor, cause I'm a taker

Cause I'm a giver, it's only nature

I live for danger

All that you got, skin to skin, oh my God

Don't ya stop, boy

Somethin' 'bout you makes me feel like a dangerous woman

Somethin' 'bout, somethin' 'bout, somethin' 'bout you

Makes me wanna do things that I shouldn't

Somethin' 'bout, somethin' 'bout, somethin' 'bout you

All girls wanna be like that

Bad girls underneath, like that

You know how I'm feeling inside

Somethin' 'bout, somethin' 'bout

All girls wanna be like that

Bad girls underneath, like that

You know how I'm feeling inside

Somethin' 'bout, somethin' 'bout

Somethin' 'bout you makes me feel like a dangerous woman

Somethin' 'bout, somethin' 'bout, somethin' 'bout you

Makes me wanna do things that I shouldn't

Somethin' 'bout, somethin' 'bout, somethin' 'bout you

All girls wanna be like that

Bad girls underneath like that

You know how I'm feeling inside

Somethin' 'bout, somethin' 'bout

All girls wanna be like that

Bad girls underneath like that

You know how I'm feeling inside

Somethin' 'bout, somethin' 'bout

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

(Somethin' 'bout, somethin' 'bout, somethin' 'bout you)

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

(Somethin' 'bout, somethin' 'bout, somethin' 'bout you)

What is ghe solution to this equation?
02(x - 20) = 44 - x

Answers

X= 40 is the answer to this equation

The given equation can be solved to obtain x = 40.

What is a Linear equation?

A linear equation is a equation that has degree as one.

To find the solution of n unknown quantities n number of equations with n number of variables are required.

The given linear equation can be solved as follows,

0.2(x - 20) = 44 - x

=> 0.2x + x = 44 + 0.2 × 20

=> 1.2x = 48

=> x = 48/1.2

       = 40

Hence, the value of x for the given equation is found to be 40.

To know more about Linear equation click on,

brainly.com/question/11897796

#SPJ5

The following is a recipe for Gazpacho, a cold vegetable soup. Write how much of each item in the
recipe you would need to serve 10 people, assuming each would eat one serving.
Gazpacho
Yield: 4 servings
1 ½ lbs of fresh tomatoes
1 c peeled, chopped cucumber
½ c chopped red bell pepper
½ c chopped red onion
1 small jalapeno
1 garlic clove
¼ c olive oil
1 lime, juiced
2 tsp balsamic vinegar
2 tsp Worcestershire sauce
½ tsp cumin
1 tsp salt
¼ tsp black pepper
2 Tsp basil

Answers

9514 1404 393

Answer:

  replace recipe quantities:

  1/4 ⇒ 5/8; 1/2 ⇒ 1 1/4; 1 ⇒ 2 1/2; 1 1/2 ⇒ 3 3/4; 2 ⇒ 5

Step-by-step explanation:

The given recipe serves 4, so must be multiplied by 10/4 = 5/2 to make it make 10 servings.

The numbers in the recipe (ignoring units or ingredients) are ...

  1/4, 1/2, 1, 1 1/2, 2

Each of these numbers needs to be multiplied by 5/2 to get the number for the larger recipe.

  1/4 × 5/2 = 5/8

  1/2 × 5/2 = 5/4 = 1 1/4

  1 × 5/2 = 5/2 = 2 1/2

  (1 1/2) × 5/2 = 3/2 × 5/2 = 15/4 = 3 3/4

  2 × 5/2 = 5

Then, to make the larger recipe, rewrite it with the quantities replaced as follows:

  old value ⇒ new value

  1/4 ⇒ 5/8

  1/2 ⇒ 1 1/4

  1 ⇒ 2 1/2

  1 1/2 ⇒ 3 3/4

  2 ⇒ 5

__

For example, 1 1/2 lbs of fresh tomatoes ⇒ 3 3/4 lbs of fresh tomatoes

_____

Additional comment

If you actually want to create the recipe, you may find it convenient to use a spreadsheet to list quantities, units, and ingredient names. Then you can add a column for the quantities for a different number of servings, and let the spreadsheet figure the new amounts. (A spreadsheet will compute quantities in decimal, so you will need to be familiar with the conversions to fractions--or use metric quantities.)

If the measures of two angles of a triangle are 102° and 27°, what is the measure of the third angle?
The measure of the third angle isº

Answers

Step-by-step explanation:

therefore the third angle is 51 degrees

Caitlin earns $7.00 an hour doing yard work for her neighbor. She worked 3 hours Friday, 4 hours Saturday, and more hours Sunday. She earned $77.00 for the weekend. How many hours did she do yard work on Sunday?

Answers

Answer: 4 hours

Step-by-step explanation:

$77.00 divided by $7.00 = 11 hours

11 hours- 3 hours (Friday)- 4 hours (Saturday)= 4 hours on Sunday

A total of 7 hours worked on Fri. and Sat.

Answer:

Caitlin worked 4 hours on Sunday.

Step-by-step explanation:

The answer is 4 hours because 7.00 multiplied by 7 (Because 3 + 4 = 7) is 49.00 and 77.00 minus 49.00 = 28.00 and since 1 hour = 7.00 and 7.00 multiplied by 4 is 28.00 then the answer must be 4 hours.

P.S Can I have brainliest?

PLSSSSSSSS HELLLLLPPPPPPP!! BRAINLIEST FOR CORRECT ANSWER!!!!!!!!!!!!!!Find the amount paid for the loan. $2400 at 10.5% for 5 years

Answers

So they pay $1,260 in interest with I=PRT
add that to the principle, which gives you $3,660

Answer:

3,660

I hope this helped

Please help ASAP brainliest for correct answer

5.6 litres to nearest 0.5litres

Answers

5.5 or 6 litres.

not sure though, let me know if I’m incorrect lol.

have a good day!

ashley is 4 years less than 3 times savannahs age. if ashley is 29 years old, how old is savannah? please help!

Answers

Answer:

11 years old

Step-by-step explanation:

Let x be Savannah's age

Ahsleys age should be 4 years less than three times Savannah's age

3x (Savannah) - 4 (years)

Then, you make an equation.

29 years old = 3x-4

simplify:

add four on both sides

33=3x

divide by three on both sides

x=11

What is 5% of £320? I really need to know

Answers

Answer:

5% of 320 is 16

you multiply 320 by .05 to get 16

Answer: 16

Step-by-step explanation:

Solution for What is 5 percent of 320:

5 percent *320 =

(5:100)*320 =

(5*320):100 =

1600:100 = 16

Now we have: 5 percent of 320 = 16

How fast is 5,280 feet= 1 mile
in feet per second

Answers

Answer:

10.560

Step-by-step explanation:

you can just use the calculator!

Answer:

62.5 i think... sorry if im wrong

Step-by-step explanation:

i hope this helps :3

If 9(x-9) = -11, then x= ?
A. - 92/9
B. -20/9
C. - 11/9
D. -2/9
E. 70/9

Answers

The answer is x= -11/9

ill give yall sloppy topy if yall answer ​

Answers

u gone give us whattt ??

Answer:

I'm good but your answer is B. or the Second option among your choice of answers

An Avon sales lady buys a make-up kit for $120 and sells it for $65 more. What is the percent of markup? 37.5%

Answers

Answer: 54.2%

Step-by-step explanation:

The percent mark-up refers to how much higher you sell a product than what you bought it for expressed as a percentage of what you bought it for.

In this case, the woman bought it for $120 and sold it for $65 more.

Cost = $120

Markup = $65

Markup percentage = 65 / 120 * 100%

= 54.2%

5/7(14-21x)=115
what is the answer?

Answers

Answer:

-7

Step-by-step explanation:


Louis has $300 to spend on a pair of skis. Sales tax is 8.5%
Part A
Decide if each description of a price and discount, plus sales tax, is an amount Louis could pay with the money he has to spend on skis.
Select Less than or equal to $300 or More than $300 for each description
20% off $339
Less than or equal to $300
More than $300
$15 off $310
Less than or equal to $300
More than $300
25% off $365
Less than or equal to $300
More than $300
$20 off $300
Less than or equal to $300
More than $300

Answers

Answer:They are all Less Than

Step-by-step explanation:

What is the exponent in the power of 10?

Answers

X^10 the exponent would be 10

ah hurry!

In a bag, you have a strip of paper with the numbers 1-10 written on the strips. If one strip of paper is pulled from the bag and then replaced, what is the probability of the following events:
pick the number 3 and then picking the number 6.

A: 1/100
B: 1/10
C: 3/10
D: 6/10

Answers

Answer: A

Step-by-step explanation: 10x10=100

please help me i really dont know this

Answers

Answer:

Okay, so..if i am thinking correctly you would have to times the numbers the original way that you would multiply anything with... then the remainders im sure that you probably just have to add those in...

(listen i am not so sure about this, i am in 6th grade...but hopefully i helped a little, sorry if i didn't help at all, i rly am... :) )

Step-by-step explanation:

HOPE I HELPED SORRY IF NOT, DON'T COUNT ON MY HELP..

I really am sorry if i didn't help y'all out... :/

<3

The first basketball player scored six points in eight minutes the second basketball player scores 10 points in 12 minutes which basketball player scores more points per minute

Answers

The second basketball player scores more because 10/12 is more than 6/8

a shoe store has a sale in which all shoes are priced at $33.00. the original price was $44. what is the percent of discount. ​

Answers

Answer:

44 - 33 = 11

11/44 X 100 = 25%

Step-by-step explanation:

find the difference between the original price and new price (change)

change/original price X 100 = percentage change

In a right triangle, the length of one leg is 20 units. The length of the other leg is 12 units. What is the length of the hypotenuse?

Answers

The required measure of the hypotenuse length is √544. Option D is correct.

In a right triangle, the length of one leg is 20 units. The length of the other leg is 12 units.

What are Pythagorean triplets?  

In a right-angled triangle, its side, such as hypotenuse, perpendicular, and base is Pythagorean triplets.

Here,
Apply Pythagoras' theorem,
(hypotenuse)² = sum of the square of the legs,
(hypotenuse)² = 20² + 12²
(hypotenuse)²  = 544
hypotenuse = √544

Thus, the required measure of the hypotenuse length is √544. Option D is correct.

Learn  more about Pythagorean triplets here:

brainly.com/question/22160915

#SPJ2

What is the price per lb of brand X coffee
if 8 lb were mixed with 12 lb of brand Y
coffee which costs $9/Ib to make 20 lb of
Mark's special coffee blend which costs
$13/1b?

Answers

Answer: x = 8/4 = 2

12(2) + 4(6) = 24 + 24 = 48 = 6*8

Step-by-step explanation:

$12X + $6(4) = (X+4)*$8

12X + 24 = 8(x+4)

12x + 24 = 8x + 32

12x + 24 - 8x - 32 = 0

4x - 8 = 0

4x = 8

x = 8/4 = 2

what is the sum of the interior angles of a polygon that has 16 sides

Answers

2520
16-2=14x180=2520

A block of silver is weighing 8 ounces is worth $104. What is the unit rate for the Value of silver in one ounce

Answers

Answer:

Blockof silver's wieghing = 8 ounces

total rate = $104

therefore, one ounce=$104/8= $13

Other Questions
Which of the following is one of the greatest effects of the agricultural revolution 2 2/5 multiplied by 2 multiplied by 3 1/5 pls someone plsss help meeeee There once was a ship that put to seaThe name of the ship was the Billy of TeaThe winds blew up, her bow dipped downO blow, my bully boys, blowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goShe had not been two weeks from shoreWhen down on her a right whale boreThe captain called all hands and sworeHe'd take that whale in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goBefore the boat had hit the waterThe whale's tail came up and caught herAll hands to the side, harpooned and fought herWhen she dived down lowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goNo line was cut, no whale was freedThe Captain's mind was not of greedAnd he belonged to the whaleman's creedShe took that ship in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goFor forty days, or even moreThe line went slack, then tight once moreAll boats were lost, there were only fourBut still that whale did goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goAs far as I've heard, the fight's still onThe line's not cut and the whale's not goneThe Wellerman makes his regular callTo encourage the Captain, crew, and allSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and go Please help Im stuck!!!! PLEASE HELP I NEED THE ANSWER QUICK!!! What is the Length/ value of N is 63 / 168 equivalent to 312 / 832 Which Pope wanted to liberate Jerusalem from Muslim control? A 14.0 tank contains 250 g of methane (CH4) gas at 27 atm at 298 K. Accidentally, 190 g of CO2 was added to the tank. What will be the resulting pressure of the mixture in the tank? Assume that no CH4 leaked out as the CO2 gas waa being added. Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) PLEASE HELP!! I'LL GIVE BRAINLEST!!Use the formula P = 2l + 2w. Find the perimeter of a rectangle with a length of 12.9 ft and a width of 19.3 ft. Show all of your work. (4) NH3+02- NO+H2Obalance the equation Find the slope intercept equation of the line Ryan buys a baseball bat. The original price is $20. Ryan has a coupon for a 20% discount. What is the sale price? Which can provide the most energy in an ecosystem?a mushroom ,a coyote, a pine tree ,a grassy meadow Please HELP what is the slope-intercept equation slope: -2 y-intercept: 3 Please help me with this question please!!!Look at the picture provided and answer the question >>Select one only.Q:An aromatic hydrocarbon is represented by which structural formula?>>Choose one answer from the picture below that answers the question above ABCD Angel and his 2 sisters shared 1/2 cup of baby carrots. How many cups did they each get? How does biology affect behavior?