Help please due today!

Help Please Due Today!

Answers

Answer 1
12

Square of 13 equals 169

Square of 5 equals 25

169-25= 144

144 square root equals 12
Answer 2

Answer:

12 is the answer

(Also have a nice day!)


Related Questions

Practice Triangle Ratios (Sides) Find the value of c. Round to the nearest tenth!

Answers

Answer:

30.67

Step-by-step explanation:

Given the following

Opposite side = x

Adjacent = 17

Angle = 61degrees

Using the SOH  CAH TOA identity

tan theta = opp/adj

tan 61 = x/17

x = 17tan61

x = 17(1.8040)

x = 30.67

Hence the value of x is 30.67


If 5x-3=3x+5, what is the value of 2X-8? 5

Answers

Answer:

5x-3=3x+5

5x-3x=5+3

2x=8

x=8/2

x=4

Therefore,

Value of 2x-8

Substitute the value of x

2(4)-8

8-8=0

If you are helped with my answer pls tag me brianliest

I really want it

Plss

THANK you.....

A XYZ is an equilateral triangle.
X
2
3
Z
Y
What is the measure of Z 2?
HURRY AND NO LINKS

Answers

Answer:

The value of the angle is 60 degrees

Step-by-step explanation:

Here, we want to find the value of the angle marked 2

From the question, we can see that we have three marked interior angles

These are the angles 1, 2 and 3

Mathematically, the interior angles of an equilateral triangle are equal

This means that each of the interior angle of an equilateral triangle measures 60 degrees

Hence, this means that the value of the angle marked 2 is 60 degrees

Baking Brownies
A brownie recipe needs one cup of sugar for every 1⁄2 cup of flour to make a batch of cookies. To make multiple batches, we represent the relationship between flour and sugar with the function f = 1⁄2 s where f is the number of cups of flour and s the number of cups of sugar. What graph represents this relationship?

Answers

Answer:

A

Step-by-step explanation:

A because it is the only one the recipe calls for 1 cup of sugar and 1/2 cup of flour, the point is in the middle but also on one.

The three lines represent the amount of water, over time, in three tanks that are the same size. Which tank is filling most quickly?

Answers

Answer:

Tank A

Step-by-step explanation:

Got it right on Kahn

Find the height of the pyramid.
Volume

Answers

Answer:

5

Step-by-step explanation:

like my answer please...

The circumference of a circle is 20.724 yards. What is the circle's diameter?

Answers

Answer:

approximately 6.6 yards :)  

Step-by-step explanation:

Answer:

6.6

Step-by-step explanation:

take pi as 3.14

formula for circumfurence is 2*pi*r

so 2r=20.724/pi

2r=6.6

since diameter is 2 radius, the diameter is 6.6

Shen invested in a savings bond for 4 years and was paid simple interest at an annual rate of 6%. The total interest that he earned was $2160. How much did he invest?

Answers

Please check the image I sent the answer is $9000

A small car has a tire with a 13-inch diameter. A truck has a tire with a 29-inch diameter. How much farther than the car does the truck have to drive for its tire to complete one revolution?

Answers

Answer:

50.27in

Step-by-step explanation:

Given data

Diameter of small tire= 13in

Radius= 13/2= 6.5in

Circumference= 2πr

C= 2*3.142*6.5

C= 40.85 in

Diameter of Big tire= 29in

Radius= 29/2= 14.5in

Circumference= 2πr

C= 2*3.142*14.5

C= 91.118in

Hence the difference in distance between the two tires after on revolution is

=91.118-40.85

=50.27in

Using the graph, determine the coordinates of the vertex of the parabola

Answers

The answer is (2,-1)

Damien deposited $250 in an account that earned 3.75% interest compounded annually. He did not make additional deposits or withdrawals. What will be the balance in this account at the end of 4 years? $127.26 $287.50 $289.66 $370.50

Answers

Answer:

$289.66

Step-by-step explanation:

A=P(1+r)^t

P=250

r= .0375

t= 4

A=250(1+.0375)^4

A= 289.66

$ 289.66 will be the balance at the end of the 4 years.

What is compound interest?

One of the most important ideas in finance is compound interest, which means that the interest you earn each year is added to your principal and grows at a growing rate. It serves as the foundation for everything from a personal savings strategy to long-term stock market development. It also takes into consideration the effects of inflation and the relevance of debt repayment.

Given, Damien deposited $250 in an account that earned 3.75% interest compounded yearly. Hence,

principal amount = 250

rate = 3.75%

time period = 4

From compound interest formula  (A) = [tex]P(1 + \frac{r}{n})^{nt}[/tex]

Final amount (A) =  250 ( 1 + 3.75/ 1)^4 = 289.66

Therefore Damien will have 283.66$ at the end of the four years.

Learn more about compound interest here:

https://brainly.com/question/29335425

#SPJ5

The parent function of a quadratic equation is vertically stretched by a factor of 2, then translated 4 units left and one unit down

Answers

Answer:

[tex]f"'(x) = 2(x-4)^2 - 1[/tex]

Step-by-step explanation:

Given

[tex]f(x) = x^2[/tex] --- the quadratic function

Vertically stretched by 2

Translation: [tex]4\ units[/tex] left and [tex]1\ unit[/tex] down

Required

Determine the new function

[tex]f(x) = x^2[/tex]

The rule for vertical stretch is:

[tex](x,y) \to (x,ay)[/tex]

In this case:

[tex]a = 2[/tex]

So, we have:

[tex]f(x) = x^2[/tex]

[tex]f'(x) = a * f(x)[/tex]

[tex]f'(x) = a * x^2[/tex]

Substitute: [tex]a = 2[/tex]

[tex]f'(x) = 2 * x^2[/tex]

[tex]f'(x) =2x^2[/tex]

Translation: 4 units left

The rule is:

[tex](x,y) \to (x - c,y)[/tex]

In this case: [tex]c =4[/tex]

So, we have:

[tex]f"(x) = 2(x - 4)^2[/tex]

Translation: 1 unit down

The rule is:

[tex](x,y) \to (x,y-d)[/tex]

In this case, [tex]d=1[/tex]

So, we have:

[tex]f"'(x) = f"(x) - 1[/tex]

[tex]f"'(x) = 2(x-4)^2 - 1[/tex]

WILL GIVE BRAINLIEST!!!

Michelle weighs 90 pounds, which is 120% of what she weighed two years ago. How much did she weigh two years ago?

A) 108 pounds
B) 75 pounds
C) 175 pounds
D) 88 pounds

Answers

B. Michelle weighed 75 pounds two years ago

What is the constant of proportionality between y and x in the graph? (WILL MARK BRAINLIST IF RIGHT!)

Answers

Answer:

2

Step-by-step explanation:

4 can be divided by 2 & 2 can be divided by 2

What’s the answer?
Needed now

Answers

I enliven to 50 I believe 340

When given the picture using what you know find the answer. What is m

Answers

Answer:

40 degrees

Step-by-step explanation:

Answer:

Angle E = 25 deg because of reflective

Angle C = 115 degree because 180 - 65

Since triangle = 180 deg

Angle D = 180 - 115  - 25

= 40 deg

Step-by-step explanation:

The retangular prism shows is made from cubs.Each cube is 1 cubic unit. What is the volume in cubic units

Answers

Answer:

72 square units

Step-by-step explanation:

To get these, we will use the attached diagram as a case study

Since each cube is 1cubic unit, hence the length of the side of a cube is 1unit

From the diagram

Length  = 6units

Width = 3 units

Height = 4units

Volume of the prism = Length * Width * Height

Volume of the prism = 6 * 3 * 4

Volume of the prism = 18 * 4

Volume of the prism = 72 sq.units

Hence the volume of the prism is 72 square units

what is 4 3/4 + 6 4/5​

Answers

Answer:

[tex]11 \frac{11}{20}[/tex]

Step-by-step explanation:

Answer:

11.55

Step-by-step explanation:

Does anyone know what is the measure for these need help on this

Answers

4. 66
5. 48
6. 60
7. 108
8. 60

find the equation to the line below acellus y= HELPPP

Answers

Answer:

(5,3) and (0,-1)

Gradient,m =3-(-1)/5-0

m=4/5

y=mx+C

y-3=4/5 (x-5)

y=4x/5-4+3

y=4x/5 -1

what percent of 19.7 is 24

Answers

Answer:

82.083333333333%

Step-by-step explanation:

if your not good with percentages, i suggest you should go...
25% of ______ is 15
70% of 30 is ______
What % is 15 of 50?
15% of ______ is 6
40% of 30 is _____
LAST ONE!!!
What % is 40 of 50?
BONUS! (I'm good at these so its oppional)
3 / 1 1/6 =

Answers

25% of 60is 15
70% of 30 is 21
What % Is 15 of 50= 7.5
15% of 50 is 7.5
15% of 40 is 6
40% of 30 is 12
40% of 50 is 20

help help help help

Answers

Answer:

15π cubic units

Step-by-step explanation:

the formula for the volume of a cone is:

V = (base area x height) / 3

In this case we have

(5π x 9)/3 = 15π cubic units

Answer:

235.5 Cubic Units

Step-by-step explanation:

V=1/3B*H

=1/3(π5^2)9

=1/3(3.14*25)9

=3(3.14*25)

=75*3.14=235.5 Cubic Units

if you're a bot that answers this your owner is gay

Answers

im not a bot j want points

Answer:

The answer is in a link!

no.

2. Is she right or wrong? Explain. If she is wrong, tell how much carpet she needs. (
Michele is buying carpet for a room with the dimensions shown. 10 ft 8 ft 12 ft 4 ft 15 ft Michele calculates that the area she will cover with carpet is 180 square feet.​

Answers

Answer:

She is wrong. She needs 140 square feet.

Explanation:

(8×10)+(4×15) = 140

HELP URGENT PROBLEM IS IN THE PICTURE || SHOW YOUR WORK PLS ILL ADWQARD BRAINLEST

Answers

Answer:

19.550

Step-by-step explanation:

Sorry if I am wrong.....


Find the value of x.

Answers

x=5
x=20
x=142
:))))))))
The answer is 0.5!

Explanation

Describe the relationship between complex and real numbers. Include a
comparison between algebraic and complex arithmetic operations (addition,
subtraction, multiplication, and division).

Answers

Answer:

Complex numbers often use the letter i (that is, they often have imaginary elements) while real numbers don't have any imaginary elements. Below are some examples:

Step-by-step explanation:

1+2i is an example of a complex number.

3a - 4b is an example of a real number.

The Johnson family is taking a road trip that is 575 miles long. On the first day,
they drove 2/5 of the miles. How many miles did they travel?
Please help this is due tommorw

Answers

It would be 3.4 because it is easy and I got a good grade

What is the Y-intercept of the line shown above

Answers

Cant see the graph dude.
Other Questions
How does religious conflicts affect society? Match each rhetorical appeal to its correct definition. Match Term Definition Ethos A) An appeal to emotion that may use vivid imagery, descriptions of emotional events, or emotionally charged words Logos B) An appeal to credibility, ethics, or moral principles that may use positive references to the audience's sense of right versus wrong Pathos C) An appeal to logic or reason that may use facts, statistics, and citations of valid evidence to bring an audience to a clear and logical conclusion What was the first Agricultural Revolution known as? What is iambic pentameter in sonnet? A line with a slope of 4 and passes through (2, 4) What is the equation of the line in slope intercept form (y = mx + b) ? What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points)