HELP PLEASE
Which would bring out the details in a tire track in mud?
A)casting an impression with dental stone
B)burning magnesium ribbon
C)casting an impression with putty
D)photography with direct lighting

The correct option is D) photography with direct lighting because it clearly shows the path and details of the tiretrack.

Tire marks can be seen on snow, mud, soil, sand, and even victims of crime scenes. These traces can be collected by photographing, pouring, lifting, and collecting the victim's clothing.

Tire marks are classified as evidence of the pattern, as tire marks leave a unique pattern. Just as shoe marks help narrow down brands, styles and sizes so can tire trucks.

Thus it clearly concludes that photography with direct lighting can collect great evidence.

To know more about tire track evidence refer to the link :

https://brainly.com/question/13397634

Project: Strategies for Effective Communication
In the lesson, there is a chart of strategies for effective communication. You will use this chart to complete your assignment. Select eight of the strategies. For four of the strategies, describe a situation where a team member models effective communication. For the other four strategies, describe a situation where a team member exhibits a breakdown in communication. Each scenario must be at least one paragraph in length.

For example: If the strategy was to always greet a patient in a positive and friendly way, we could describe a situation where a health care worker modeled this behavior or a situation where a health care worker did not act appropriately.

After you complete your scenarios, do some research online or in the library. Find at least two more strategies for effective communication. Provide an example of ineffective communication and effective communication related to each strategy. Discuss why you selected each strategy and how you think each strategy can be useful in effective communication. Make sure that you select strategies that were not mentioned in the chart or used as an example in the lesson.

Use the restriction enzyme EcoRi to cut DNAVictim DNA :
GGAAG ATTCTACATTACTGACGGACGTGACGTGA
CCTTCTTAA GATGTAATGACTGCCTGCACTGACT
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 1 DNA :
GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAA
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 2 DNA :
CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGG
GGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCC
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :


PLEASE HELPPP!!!!
I WOULD APPRECIATE A LOT :)

What is the function of the serous membrane? (Be specific about what types of body cavities)

Going about her cleaning routine as usual, Jayla sprays an aerosol bleach cleanser in her bathroom and then leaves to let it air out before she scrubs it down. Only two or three minutes later, she notices her cat, Grimaldi, fleeing the bathroom, coughing. Jayla hadn’t realized that Grimaldi was in the bathroom when she sprayed the chemical, so she rushes over to check on him. He seems to be wheezing and shaking a bit. Calling the vet, he asks Jayla to explain how Grimaldi was exposed to the chemical. Hearing Jayla’s explanation, which method of poisoning will the vet MOST likely assume Grimaldi is dealing with?

ingested poison

absorbed poison

injected poison

inhaled poison

Solve: -3x+1<-5
X>
X> 2
4
x<-2

How do blood types react in a transfusión ?

The main idea behind Maslow’s hierarchy of needs is that
the most important needs must be met before the less important human needs can be met.
all needs are equally important and must be met simultaneously to achieve full health and success.
there are a few less important needs that must be met before the many important needs can be met.
all needs are equally important and their ability to be met can vary in timing.

how do I make a homemade bandaid ​

What is ischemia?
O medication to treat myocardial infarctions
O type of heart damage
O branch of the coronary arteries
O insufficient blood supply to the heart
PLEASE HURRYYYYY

What is the cause of the Carona Virus?
Or is the cause unknown.

NAME THIS SONG AND ARTIST
Karma police
Arrest this man
He talks in maths
He buzzes like a fridge
He's like a detuned radio
Karma police
Arrest this girl
Her Hitler hairdo
Is making me feel ill
And we have crashed her party
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
Karma police
I've given all I can
It's not enough
I've given all I can
But we're still on the payroll
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself

Sylvester is dealing with hearing loss. The doctor informs him that his basilar membrane is damaged. What type of hearing loss is Sylvester experiencing

Use the drop-down menus to select the best
answers.
Some myocardial infarctions involve erratic heart
behavior, such as

1.creating more carbon dioxide.
2.missing beats.
3.producing more oxygen.
4.pumping more blood.

PLEASE HURRY

which is the earliest school of medicine known to mankind??​

Which represents the order of increasing educational levels?
professional –assistant-technologist-technician
technologist –assistant-professional-technician
technician –professional-technologist-assistant
assistant –technician-technologist-professional

Size-wise, your heart occupies about_____ of the space in your upper chest.

A. 1/10th
B. 1/4th
C. 1/2
D. 1.20th

16. The use of an electronic signature needs to be in compliance with
ОНІРАА.
O AMA.
Ostate laws.
O HEDIS.

What is the healthy percentage of body fat for men?

why are technical schools established?​

Complete the sentence to describe a procedure for food animals. Bulls are to improve the quality of beef, and to make the animals easier to manage.

Which structure is correctly described as exhibiting bilateral symmetry
O fingers that are distal to the arm
O an eye on each side of the sagittal plane
O a bely button along the medial area of the body
O the head in the upper portion of the transverse plane

MEDICAL TERMINOLOGY!!