HELP NEED ANSWER IN 6 MINS!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!11

HELP NEED ANSWER IN 6 MINS!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!11

Answers

Answer 1

Answer:

The first one is yes, and the second is

Step-by-step explanation:

10/1     so actual distance changes by 10 every one inch on the map and the map distance by 1 every ten miles in actual distance


Related Questions

04.01 mc y-2x=-1 and 2y-x=4 choose the correct graph of the given systems of equations

Answers

Answer:

1st one  m=0

y= 0.49875311x  / cm

No horizonal asymptotes

x= 1/2 + 2.005 mcy

2nd one is

slope 1/2

y intercept (0,2)

x      y

-4     0

0       2

Step-by-step explanation:

for 2

starting point ay y 2 make a point

then rise over run

go up 1 and to the right 2 and point , then up 1 and to the right 2 and point

there is your graph

Solve 4q = 52
Q=
Which statement shows the correct justification for the step used to solve the equation

Answers

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

[tex]4q = 52[/tex]

Divide sides by 4

[tex] \frac{4q}{4} = \frac{52}{4} \\ [/tex]

Simplification

[tex]q = 13[/tex]

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

This is really confusing i need help if you get this right i will give you brainliest

Answers

Okie B or D

Maybe C

OK ok ok ok ok ignore that it's probably B? orC

okie nevermind there's lots of bullies and no one even know's I'm autistic people, okie baiiiii

Answer: I don't think the answer is B. -3/5+(-2/8)-4=-5 because B. -3/5+(-2/8)-4 A. (-40)+(-30)+28=-42, C. 130+70+(-37)=163, D. 40+(-58)+160=142. I think A. (-40)+(-30)+28=-42

At a winter concert, the ratio of the number of boys to the number of girls is 3:8. if there are 250 more girls than boys, how many
boys are at the concert?​

Answers

Answer:

150

Step-by-step explanation:

if 3:8 , that means the difference is 5. the difference is 250, so 250/5 =50.

then u multiply 3 by 50 and get 150. ur welcome man

Which scenario below represents 85%?

Answers

Show us the scenario

PLEASE HEEEEELLLPPPPP ILL GIIVE YOU BRAINLIEST

Answers

Answer:

your answer will be c

and distributive property for the second one

Step-by-step explanation:

the answer should be D for both, correct me if i'm wrong

Select all the lines in the proof of △ABC≅△CDA that have the correct justification. AB || CD and BC || AD, ASA Triangle Congruence Theorem ∠BAC≅∠DCA, Alternate Interior Angles Theorem △ABC≅△CDA, SAS Triangle Congruence Theorem ∠ACB≅∠CAD, Alternate Interior Angles Theorem AC≅AC, Reflexive Property of Congruence

Answers

Answer:

AB and MN

∠B and ∠N  

CB and LN

Step-by-step explanation:

edg

John is twice as old as Mary. The sum of their ages is 21. How old is Mary?
Let J = John's age and M = Mary's age. Select the system equations that represents the problem.
J - 2M = 0
J = M + 2
M - 2J = 0
J + M = 21

Answers

Answer:

Mary is 7

Step-by-step explanation:

If their ages combined equals 21 and john is twice Mary’s age then johns age takes up 2/3 of 21. that would b 14. 14 is 2 x 7. and Mary is 7. 14+7=21. Mary is 7 years old

Correct answers are:

J + M = 21

J - 2M = 0

In a full set of permanent teeth, 1/4 of the teeth are incisors, 1/4 are premolars, and 3/8 are molars. What fraction of all the teeth are incisors, premolars, and molars

Answers

Answer:

7/8

Step-by-step explanation:

In a full set of permanent teeth, 1/4 of the teeth are incisors, 1/4 are premolars, and 3/8 are molars. What fraction of all the teeth are incisors, premolars, and molars?

To solve the above, we add all the fractions together.

= Incisors + Premolars + Molars

= 3/8 + 1/4 + 1/4

Least Common Denominator = 8

= (3 × 1 + 2× 1 + 2 × 1)/8

= 3 + 2 + 2/8

= 7/8

Hence, the fraction of all the teeth are incisors, premolars, and molars is 7/8

Trisha uses 3 cups of sugar for every 4 cups of flour to make a batch of cookies. Which equation could be used to solve x, the number of cups of flour needed for 9 cups of sugar.

Answers

Answer: The number of cups of flour needed for 9 cups of sugar = 12.

Step-by-step explanation:

Equation of direct proportion between two quantities x and y :

[tex]\dfrac{x_1}{y_1}=\dfrac{x_2}{y_2}[/tex]

Let x=  the number of cups of flour needed for 9 cups of sugar.

Put [tex]x_1=4,\ y_1=3,\ y_2=9, x_2=x[/tex]

[tex]\dfrac{4}{3}=\dfrac{x}{9}\\\\\Rightarrow\ x=\dfrac{9\times4}{3}\\\\\Rightarrow\ x=12[/tex]

Hence, the number of cups of flour needed for 9 cups of sugar = 12.

pls help−4(3/2x−1/2)=−15

Answers

Answer:

17/6

Step-by-step explanation:

what you do first is open up the brackets..

so

-4 x 3/2x and -4 x -1/2

you then multiply these

-12/2x and 4/2

-6x and 2

(-6x+2) = -15

solve for x

-6x=-15 -2

-6x=-17

x=17/6

crossing out the negatives !

Find the unit rate. Round your answer to the nearest hundredth.
3500 calories for 6 servings of pie

Answers

3500cals/6 servings

583 1/3 cals per serving.

583 calories per serving.

4(c + 3) = t
solve for c

Answers

Answer:

c=1/4t-3

Step-by-step explanation:

2³ =
what does it equal?

Answers

Answer:

8

Step-by-step explanation:

2 x 2 = 4

4 x 2 = 8

Answer:

8

Step-by-step explanation:

2^3 is the same as 2x2x2 (x is times)

I need some help and fast
Solve this plz

Answers

Answer:

It could be or 70 or 78

Step-by-step explanation:

Answer:

there the same they are both 84

Step-by-step explanation:

Two bags of bird seed are used to fill these three bird feeders. How much bird seed does each feeder use? Represent the situation using the model. Then solve

Answers

Step-by-step explanation:

If two bags of bird seed are used to fill these three bird feeders, then we can say that;

2 bags of bird seed = 3 bird feeders

To know the amount of bird seed that each feeder use, we will say;

x bags of bird seed = 1 bird feeder

Equating both postulates and solving

2 bags of bird seed = 3 bird feeders

x bags of bird seed = 1 bird feeder

Cross multiply

3 * x = 2 * 1

3x = 2

subtract 2 from both sides

3x - 2 = 2-2

3x - 2 = 0

Hence model that represents the situation us 3x - 2 = 0 where x is the number of bird seed that each feeder use.

Next is to solve for x;

3x - 2 = 0

3x = 2

x = 2/3

Hence each feeder used 2/3 bird seed

Fraction 3•5 • fraction 4•9 =

Answers

Answer:

Step-by-step explanation:

3.5×4.9

=35/10×49/10

=1715/100

Or 17.15 answer

Answer:

Step-by-step explanation:

3/5 times 4/9. multiply straight across. 3 times 4 is 12. 5 times 9 is 45. your answer is 12/45. but this answer can be simplified if we take out a 3 for each one. so you have 4/15

Martha compra 2 kilos de tomate y 1 kilo de cebolla pagando S/ 8,40. Si la siguiente semana compra 1 kilo de tomate y 2 kilos de cebolla pagando S/ 7,80, ¿a cuánto está el kilo de cebolla?

Answers

Responder:

2,40

Explicación paso a paso:

Dado que:

Dejar :

Tomate = t

Cebolla = n

(2 kilo de t) + (1 kilo de n) = 8.40

(1 kilo de t) + (2 kilo de n) = 7.80

2t + n = 8,40 - - (1)

t + 2n = 7,80 - - (2)

De (2);

t = 7,80 - 2n

Ponga t = 7.80 - 2n en (1)

2 (7,80 - 2n) + n = 8,40

15,6 - 4n + n = 8,40

15,6 - 3n = 8,40

-3n = 8,40 - 15,6

-3n = - 7,2

n = 2,4

t = 7,80 - 2 (2,40)

t = 7,80 - 4,80

t = 3

Por lo tanto, el costo de 1 kilo de cebolla es 2,40

Parker is in the business of manufacturing phones. He must pay a daily fixed cost to rent the building and equipment, and also pays a cost per phone produced for materials and labor. The equation C=175p+400 can be used to determine the total cost, in dollars, of producing pp phones in a given day. What is the y-intercept of the equation and what is its interpretation in the context of the problem?

Answers

9514 1404 393

Answer:

  400; building and equipment fixed cost

Step-by-step explanation:

The cost equation has two terms. The constant term (400) is the daily fixed cost of building and equipment. The variable term (175p) represents the cost of producing p phones.

The y-intercept is 400. It is the daily fixed cost of the building and equipment.

Answer:

The y-intercept of the function is 400 which represents the fixed cost for rent and equipment.

Step-by-step explanation:

Since Parker must pay $400 even to make 0 phones, that means $400 is the fixed cost that Parker must pay for rent and equipment regardless of the number of phones produced.

Have a good day :)

Find the value(s) of A so that XYZW is an isosceles trapezoid. All answers should be fully simplified.

Answers

Answer:

a = 4√5

Step-by-step explanation:

Given

Trapezoid XYWZ

As given, sides XW and YZ are parallel and XY = WZ

Since it is isosceles, angles X and W are of same size

Therefore:

a² + 15 = 2a² - 652a² - a² = 15 + 65a² = 80a = √80a = 4√5

how do you find the value of √a⁴ ??
(ill give brainliest)

Answers

Answer:

[tex]a^{2}[/tex]

Step-by-step explanation:

√a^4 is the same as:

√a × √a × √a × √a

group them as 2 pairs of

(√a × √a) × (√a × √a)

which makes

a × a

which is the same as [tex]a^{2}[/tex]

(picture)
for each number on the left,place a check mark under the numbers it is divisible by.​

Answers

45- 3, 5, 9

369- 3, 9

7870- 2, 5, 10

1976- 2, 4,

6003- 3, 9

136- 2, 3, 4

1674- 2, 3, 6, 9

35496- 2, 3, 4, 6, 9

what is the y-intercept of this table? i dont understand it please help thank you.

Answers

Answer:

-0.4

Step-by-step explanation:

you just take 2 of them to find it

8. Could an angle be complementary to itself? If, so what would it’s measure be?

9. Could an angle be supplementary to itself? If so, what would its measure be?

Answers

Answer:

8) angle that is complement of itself is 45°

9) When an angle is its own supplement, that means that the angle, plus itself, will equal 180 degrees.

Step-by-step explanation:

20 POINTS!
(Also explain the reasoning you used to find the expression)
ILL MARK BRAINLIEST

Answers

9514 1404 393

Answer:

  8x +96 yd

Step-by-step explanation:

The perimeter is the sum of the side lengths. In this case, it will be twice the sum of the overall length and the overall height.

The overall length is the sum of the two horizontal segments at top:

  (x -2) +(3x) = 4x -2

The overall height is the sum of the right-side vertical segments:

  10 + 40 = 50

Then the perimeter is ...

  P = 2(L+W) = 2((4x -2) +50) = 2(4x +48) = 8x +96

The perimeter is 8x +96 yards.

Anthony says that the expression abc has three terms because it uses three different variables. Critique Anthony's reasoning and explain whether he is correct.

Answers

Answer:

Anthony's reasoning is incorrect

Step-by-step explanation:

The expression abc is not made up of three terms because it is just an entity. For the expression to be called a three term expression, each of the variables must be separated using mathematical signs. For example, the expression a + b + c can be referred to as three terms because each variables are separated by a plus sign. In this case they are different entity.

From the above explanation, we can conclude that Anthon's reasoning is incorrect. The expression abc is just one term not three terms.

what is the volume of a cylinder with radius 10cm and height 10cm?

Answers

Answer:

about 3141.59 cm^3

Step-by-step explanation:

V of cylinder = (pi)(r^2)(h)

radius = 10 cm

height = 10 cm

V = pi x 10^2 x 10

V = 3141.59 cm cubed

CAN SOMEONE HELP THIS IS DUE

Hicham El Guerrouj of Morocco set a world record by running 1 mile in 3 minutes, 43.13 seconds on July 7, 1999. What was his time in miles per hour?

Answers

Answer:

His time in mph is 16.1 mph

In the equation 0.5x-8=1.5 the decimal coefficient is

Answers

Answer:-9.5

Step-by-step explanation:

Answer:

0.5

Step-by-step explanation:

The coefficient is the number that multiply the variable, in this case x.

I need help because I was debating if it’s is 5 or 6

Answers

Answer:

it should be 5.5

Step-by-step explanation:

cross multiply and solve as an equation

Other Questions
What other story element is most affected by the narrator's point of view?A) the story's titleB) the story's settingC) the story's theme Express the recurring decimal 0.56 (Just the 6 is recurring) in its simplest form. What should you ask yourself before you post a photo, video, or other information about another person online? 1. la seora Trevio tiene el doble de edad que suhijo hace 9 aos la suma de su edades era 30cual es su edad actual? ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut Philosophies born out of ancient China include____.A. BuddhismB. DaoismC. JainismD. Hinduism On a map, the distance between NY and Washington D.C. is 3.6 inches. The scale is 1 inch: 55 miles. What is the actual distance between the two cities? 31. The observed regularities in the properties ofthe elements are periodic functions of their(1) atomic numbers(2) mass numbers(3) oxidation states(4) nonvalence electrons Which describes an altocumulus cloud?a.high, feathery cloudc.low storm cloudb.puffy mid-level cloudd.high cloud made of ice crystalsPlease select the best answer from the choices providedABCD PLZZ ANSWER THE QUESTION What point of view is the poem "The Song of the Storm -- Spirits" written in? The top of the saturated zone is known as A. the aquifer B. the water table C. the unsaturated zone D. spring rock How could you explain why soap is able to clean the oil and dirt off your bodies? Which of the following would be considered a derived unit? A) length B mass C) density D) temperature La hermana de mi hermana es mi ________. find y when y = 3x^2 -2x+5 and x = -1 What provides the energy that is stored in ATP molecules?A. PhospholipidB. FoodC. BloodD. Oxygen 72x2 + 39x + 207 = 0 does your faith is still visible even in the hardest part of life how? What developments brought new life to Lincolns 1864 presidential campaign