heeeeeeelp meeee.......... pleassssssssseeeeeeeeeeeeeee............

Adam wants to buy a $35 shirt. He has $9. After two weeks of saving, he has $15. Three weeks after that, he has $24. If Adam saves money at a constant rate, will he have enough to buy the shirt after 8 weeks? Solve the problem by making a table and then making a graph...

Answers

Answer 1

Answer:60

Step-by-step explanation:

Answer 2

The answer would be 60$

Related Questions

HURRY IM BEING TIMED!!! Explain why ratios and proportions would be important when designing environments and characters?

Answers

Answer:

The ratio and proportion are the two important concepts, and it is the foundation to understand the various concepts in mathematics as well as in science. In our daily life, we use the concept of ratio and proportion such as in business while dealing with money or while cooking any dish

Step-by-step explanation:

hope this helps may i have brainliest

Answer:

Possible answer: Ratios and proportions are important skills to have because without them the environment and the characters would be in the wrong proportions and would not look realistic.

Step-by-step explanation:

Expand the following expression.

5.2(23 - 3.62x)
A.
119.6x - 18.824
B.
119.6 - 18.824x
C.
18.824 + 119.6x
D.
28.2 - 8.82x

Answers

Answer:

119.6 - 18.824x

Step-by-step explanation:

5.2 x 23 = 119.6

5.2 x 3.62x = 18,824x

= 119.6 - 18.824x

The answer is b because of it being simple

Peggy has $30 to spend on one book at the bookstore. She has a coupon for 15% off the price of one book. She will be charged 7% tax. What is the price (before she uses the coupon) of the most expensive book that Peggy could buy?

I will mark brainliest if you give an explanation

Answers

Answer:

$10.56

Step-by-step explanation:

Hope this helps! :D

30-15%+7$

HELP PLz Now!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

It will take 16 months to grow which is C

Step-by-step explanation:

Answer: 16 months

Step-by-step explanation:

8 / 1/2 = 16

16 x 1/2 = 8

So it would take her 16 months to grow her hair 8 inches.

Find the area of the figure. (Sides meet at right angles.)

Answers

2x3=6 2x3=6 5x9= 45 so 6+6+45=57 so the area of the figure is 57m^2

In Jason's baseball card
collection 62% of his cards are
from the National League. If
Jason has 50 cards, how many
players are from the National
League?

Answers

Answer:

Step-by-step explanation:

50 x 0.62 = 31

pls helppppppppppppppppppp

Answers

Answer:

Student b

]

Step-by-step explanation:

Student b

Answer:

Student B

Step-by-step explanation: A forgot that the numerator has to be bigger than the denominator on both sides for the fraction to be equal. 6/5 is not proportionate to 45/15 which equals 3

3 doesn't equal 1 and 1/5

Write the prime factorization of 363 using exponents.

Answers

The exponents in the prime factorization are 1 and 2. Adding one to each and multiplying we get (1 + 1)(2 + 1) = 2 x 3 = 6. Therefore 363 has exactly 6 factors.

363 has exactly 6 factors

Gavin saved $30,000 in a savings account. He received a 2.5% interest rate and saved for 8 years. How much interest did he earn

Answers

he earned 6000 interest in total 36000

Answer:

30000/40=750x8=$6000 in interest earned

Step-by-step explanation:

A salesperson at a jewelry store earns 8% commission each week....

Answers

Answer:

heidi earned $56 in commision.

hyou take the amount the jewerly store made, 700 in this case and divide it by 100, to find what 1% is. so 1% is 7$, multiply that by 8, since she makes 8% and that ur answer

Step-by-step explanation:

Ok so 700x0.8 will give 80% and divided by 10=8% the salesperson will earn $56 the total is out of 100,100-8= the amount the jewelry store gets meaning the remaining of the $700,700-56=644. To conclude the salesperson will get $56 and the jewelry store will get $644. Hope this helps :)

math homework pls help thanks

Answers

Answer:$74.25 for A

)624.25 for B

Step-by-step explanation:

74.25 (A)
624.25(B) hope this helps! :)

ignore my handwriting but here’s some math i need for tomorrow

Answers

FYI - 14,15,16 are correct.

17. a) 7 (nearest integer), b) 6.8 (nearest tenth)

18. a) 14 (nearest integer), b) 13.8 (nearest tenth)

19. [tex]\sqrt{40}[/tex] --> simplified to = 2[tex]\sqrt{10}[/tex]

-- let me know if you have any questions regarding this.

don't freaking troll me actually help ok

Answers

Answer:

Dam- Teachers are really into homework these days- like give us a break- It's corona- School is like super stressful-

Step-by-step explanation:

I know i didn't answer this question- sry-

Wow this is really hard I’m sorry you have to go through that

Find the area of the square pyramid represented by this net.

Answers

Answer:

2.6 cm is the answer hope it helps

answer: 64 cm^2

Area of triangle:

(6x4) / 2
24 / 2
= 12 cm^2

There are 4 triangles so:
12 x 4 = 48 cm^2

Area of square:
4 x 4 = 16 cm^2

Total area:
48 + 16 = 64 cm^2

Awarding Brainliest on this

Answers

Answer: v = 3

I guess infinite solutions

Step-by-step explanation:

2v + 5v - 8 = 13

combine like terms

7v - 8 = 13

add 8 to both side

7v = 21

divide both side by 7

v = 3

3
I’m not getting brainliest

Brainliest will be awarded

Answers

Answer:

K=-5

Hope that helped <3

look at the diagram and explain if it’s a function

Answers

Answer: In the diagram, it is a function because the domain(x) is not repeating and so it makes it a function

Step-by-step explanation: This is correct :)

This is a function because the x value is only going to 1 y value
Hope that helped :)

Solve the equation using mental math x-1/5 = 4 2/5

Answers

Answer:

Exact Form:

x = 23 /5

Decimal Form:

x = 4.6

Mixed Number Form:

x = 4 wholes 3/5

Step-by-step eplanation:

if a 6-foot man casts an 8-foot shadow, how tall is a tree that casts a 24-foot shadow?

Answers

26 , 8-6=2 so you do 24+6

Plz help!!
its not 82 and 71 combined...... its 8 and then 2/3

8 2/3 - 7 1/8

explanation!!!!!!!

Answers

Answer:

Step-by-step explanation: 37/ 24 =1 13/24 = 1.5416667

The answer would be 1 13/24

You want to do
8 2/3
7 1/8
———
But you have to have the same denominators so you (x) 1/8 by 3 and 2/3 by 8 to get

8 16/24
7 3/24
————
Then you just subtract 16 and 3 to get 13 and subtract 8 and 7 to get 1 so the answer would be 1 13/24

please asap homework help

Answers

Answer:

2700 cubic meters

Step-by-step explanation:

18*9*10=1620m

24*9*5=1080m

1620+1080=2700[tex]m^{2}[/tex]

The lowest elevations of Argentina and Peru are both below sea level. The lowest elevation in Argentina is about $345$ feet below sea level. The lowest elevation in Peru is about 1/3
the value of Argentina’s lowest elevation.

Which value best represents the lowest elevation, in feet, in Peru?

Answers

1/3 is the answer hope this helped

Need help with these two, please thanks

Answers

Answer:

the answer is 93.6

Step-by-step explanation:

Answer:

Sales Tax = $3.6

Step-by-step explanation:

$90.00 × 4% = 3.6. The Sale price is $93.6

please help TvT i dunno how many times ima say this today

Answers

Answer:

answer is #1. 3/7

Step-by-step explanation:

Please help me I will give you the brain thing with extra points, please help me. 4/5

Answers

Answer: B

Step-by-step explanation: In all the new coordinates the y coordinate becomes a negative.

can some one help me

Answers

Answer : x = 15

Explanation :

180-106= 74

74=6x-16

74+16 =6x

90=6x

x=15

Answer:

Step-by-step explanation:

6 x (-(16 degrees)) =

-1.67551608 rad

Find the area of each shaded region please help i just need help with C and D

Answers

Answer:

Step-by-step explanation:

I’m pretty sure that the answer is 78

Here is the same question but a bit bigger

Answers

Each sandwich is 6.75 dollars

Help Me with the second one plz!

Answers

Answer:

0.003

Step-by-step explanation:

multiply by 12

Answer:

Step-by-step explanation:

0.00025

please help I'll give brainliest

Answers

Answer:

x< -5

Step-by-step explanation:

we must separate the x to solve for x.

divide both sides by -3 because this separates x.

x < -5 because we switch the inequality because we multiply/divide by a negative number

Answer:

Step-by-step explanation:

The answer to the inequality is x<-5

The first blank is "divide -3" on both sides

The second blank is "flip" or switch the inequality

Other Questions

Which of the following is one of the greatest effects of the agricultural revolution 2 2/5 multiplied by 2 multiplied by 3 1/5 pls someone plsss help meeeee There once was a ship that put to seaThe name of the ship was the Billy of TeaThe winds blew up, her bow dipped downO blow, my bully boys, blowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goShe had not been two weeks from shoreWhen down on her a right whale boreThe captain called all hands and sworeHe'd take that whale in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goBefore the boat had hit the waterThe whale's tail came up and caught herAll hands to the side, harpooned and fought herWhen she dived down lowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goNo line was cut, no whale was freedThe Captain's mind was not of greedAnd he belonged to the whaleman's creedShe took that ship in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goFor forty days, or even moreThe line went slack, then tight once moreAll boats were lost, there were only fourBut still that whale did goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goAs far as I've heard, the fight's still onThe line's not cut and the whale's not goneThe Wellerman makes his regular callTo encourage the Captain, crew, and allSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and go Please help Im stuck!!!! PLEASE HELP I NEED THE ANSWER QUICK!!! What is the Length/ value of N is 63 / 168 equivalent to 312 / 832 Which Pope wanted to liberate Jerusalem from Muslim control? A 14.0 tank contains 250 g of methane (CH4) gas at 27 atm at 298 K. Accidentally, 190 g of CO2 was added to the tank. What will be the resulting pressure of the mixture in the tank? Assume that no CH4 leaked out as the CO2 gas waa being added. Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) PLEASE HELP!! I'LL GIVE BRAINLEST!!Use the formula P = 2l + 2w. Find the perimeter of a rectangle with a length of 12.9 ft and a width of 19.3 ft. Show all of your work. (4) NH3+02- NO+H2Obalance the equation Find the slope intercept equation of the line Ryan buys a baseball bat. The original price is $20. Ryan has a coupon for a 20% discount. What is the sale price? Which can provide the most energy in an ecosystem?a mushroom ,a coyote, a pine tree ,a grassy meadow Please HELP what is the slope-intercept equation slope: -2 y-intercept: 3 Please help me with this question please!!!Look at the picture provided and answer the question >>Select one only.Q:An aromatic hydrocarbon is represented by which structural formula?>>Choose one answer from the picture below that answers the question above ABCD Angel and his 2 sisters shared 1/2 cup of baby carrots. How many cups did they each get? How does biology affect behavior?