Given the following DNA strand TACGTATGCCGTATGGGCATT

a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?​

Answers

Answer 1

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.


Related Questions

Which order shows the levels of organization from largest to smallest?
O organism, organ system, cell, organ, tissue
organism, tissue, organ system, organ, cell
organism, organ, organ system, cell, tissue
organism, organ system, organ, tissue, cell

Answers

Answer:

Organism, Organ System, Organ, Tissue, Cell    

Microfilaments are a component of a cell's cytoskeleton and are made of the protein actin. They are important for giving a cell its shape and also aid in _______.
A.) Protein synthesis
B.) Cellular movement
C.) DNA replication
D.) Energy conversion

Answers

B. Cellular movement would be the answer

Microfilaments are a component of the cell's cytoskeleton and these are made up of the actin protein. They are involved in the cellular movement. Thus, the correct option is B.

What are Microfilaments?

Microfilaments are also called as actin filaments, as they consist of two intertwined strands of a globular protein, which is known as actin protein. In association with myosin, microfilaments help to generate forces that are used in cellular contraction and cellular movements. During cell division, these filaments results into dividing cell to pinch off into two daughter cells and are involved in amoeboid movements of certain types of cells.

Microfilaments assist with cellular movement due to the presence of actin filaments. Actin filament works with another protein called myosin to produce muscular movements, cell division, and cytoplasmic streaming during cell division. Microfilaments keep the organelles in place within the cell.

Therefore, the correct option is B.

Learn more about Cell shape here:

https://brainly.com/question/25827761

#SPJ2

What change to the following molecule's structure would result in a saturated fat?

Answers

Answer:

It needs to gain a Hydrogen atom to eliminate the double bond between the two carbons.  

Explanation:

Unsaturated fat has one or more double bonds in its molecule. Saturated fat has a single bond. If you want an unsaturated fat to become saturated it needs to gain more more hydrogen atoms which will eliminate the double bonds between carbons of the unsaturated fat.

Hope this helped :)  

Help please I need this I don’t understand

Answers

i dont understand too:(

Answer:

The first three boxes are Carbon dioxide (the 6th pic), water and sunlight, I cant figure out the middle box it could be nutrients, and one of the last box's is oxygen (the o)

Sorry im  not much help im doing this too and like im literally stuck!

An insertion or deletion mutation is usually has a greater affect on the protein than a
substitution mutation because-

Answers

Answer:

The awser is B

Explanation:

Type the correct answer in the box. Spell all words correctly. Which microscope allows two samples to be viewed simultaneously? Forensic scientists use the microscope to view two samples simultaneously at extreme magnification.

Answers

Answer:

Comparison microscope

Explanation:

The correct answer would be the comparison microscope.

The comparison microscope consists of two compound microscopes with a center eyepiece. The eyepiece captures and displays the images from the two microscopes and the observer can compare and contrast for investigative purposes.

The capacity to produce two images for comparison purposes makes the microscope useful in forensic investigations.

True or false based on the context in paragraph 3 a thin soft pliable sheet or layer

Answers

Answer:

Explanation:no para3 here

3. What is it called when water vapor is evaporated from plant surfaces? *
Transpiration
Respiration
Photosynthesis
All of the above

Answers

Transpiration ...............
“Transpiration is the exhalation of water water vapor through the stomata.” So I’m going to guess the first one.

Once assembled, what is the key to a protein's unique function?​

Answers

Answer:

Once assembled, what is the key to a protein's unique function? The manner in which proteins fold is the key to their function

The endoplasmic reticulum is an important  region where protein folding occur. Because proteins need to be appropriately folded into distinct structures, this is an essential biological function.

What is importance of protein folding?

Proteins that are misfolded or are unfolded improperly impart to the pathophysiology of many illnesses.

Protein folding is a highly delicate process that is regulated by a variety of external stimuli, such as temperature, pH, chemicals, molecule crowding, electric and magnetic fields, and temperature.

These elements affect a protein's capacity to fold into the appropriate functional forms.

Therefore, Protein folding give unique properties to protein functions.

Learn more about protein folding here:

https://brainly.com/question/28421475

#SPJ2

Describe the steps that your body takes when building immunity.

Please helpppp this is due today

Answers

Answer:

Explanition:

The immune system is made up of special organs, cells and chemicals that fight infection (microbes). The main parts of the immune system are: white blood cells, antibodies, the complement system, the lymphatic system, the spleen, the thymus, and the bone marrow.

4 points
The inferred temperature and pressure of Earth's
interior at a depth of 3,000 kilometers are
approximately
(1) 1000°C and 0.5 million atmospheres
(2) 1000°C and 1.0 million atmospheres
(3) 5000°C and 1.5 million atmospheres
(4) 5000°C and 3.0 million atmospheres

Answers

Answer:

(4) 5000°C and 3.0 million atmospheres

Explanation:

The inferred temperature is 5000°C and pressure of Earth's  interior is 3.0 million atmospheres at a depth of 3,000 kilometers. At the depth of 3000 kilometers, core of the earth is present which is very hot and it is mostly consist of iron. The inner core has a radius of about 1,220 kilometers while the outer core is about 1,400 miles thick which comprise of iron, Nickle, gold, platinum, and uranium elements.

Does anyone know how to do this????!

Answers

Answer:

Check from the internet

The _________________ is the hereditary material of the cell made up of sequences of four nucleotides arranged in linear strands called chromosomes.

Answers

Answer:

DNA

Explanation:

The answer is DNA. It belongs to a class of molecules called the nucleic acids, which are polynucleotides(long chains of nucleotides)

Hope this helped :)

explain how the equilibrium price is determined​

Answers

Answer:

The equilibrium price is the price at which the quantity demanded equals the quantity supplied. It is determined by the intersection of the demand and supply curves. .

A decrease in demand will cause the equilibrium price to fall; quantity supplied will decrease.

Explanation:

Not all members of a species are the same. Every species exhibits (blank)
. For example, some beetles are green, while others are brown.

Not all individuals in a population will survive to reproduce. Those that do, pass their (blank)
to their offspring.

Answers

variation and traits

Answer:

Not all members of a species are the same. Every species exhibits  

variation.

For example, some beetles are green, while others are brown.

Not all individuals in a population will survive to reproduce. Those that do, pass their traits, genes to their offspring.

Explanation:

Got it right. Hope it helps :)

Don’t comment unless you want a lot of notifications!!!


What are you if your Mexican black Asian white Hawaiian

Answers

Answer:

A human

Explanation:

I have a question.... my teacher today in biology said " you think you are moving your hand by yourself, but it's actually your brain sending commands to your muscles so they can move." So I wondered.. is my brain sending commands so I can think, or am I thinking whenever I have a desire to? (Not a trick question; My friend thinks this is a trick question lol).

Answers

Answer:

you are think of a command and your brain respond to you desire

Explanation:

What happens when two
protons get close together?
A. They are attracted to each other.
B. They repel each other.
C. Nothing happens.

Answers

Answer:

they repel each other

Explanation:

in basic chemistry:

protons repel other protons

protons are attracted to electrons

electrons repel electrons

Answer:

B. they repel

Explanation:

I'm learning the same thing lol

Maribel brings her backpack to the lab. She is also given a set of lab materials. What is the safest way for Maribel to organize these items in a lab?

Answers

Answer:

The personal items should be off the table, and the lab materials should be placed neatly away from the edge of the table.

Explanation:

It is given that Maribel goes to the lab with her backpack and she is given the lab materials to be used inside the lab to perform her experiment.

Now Maribel in the lab before doing her experiment must keep the personal items like her backpack off the working table and the lab materials are should be kept away from the edge of the table otherwise it might fall accidentally and hurt her.

One needs to be very careful while in the laboratory. One should follow the safety procedures to remain safe and also ensure safety of others. Being unsafe and disorganize can hurt others and can cause harm to others. There are various equipment and chemical in the lab. Therefore one should be careful while working in the lab.

When the concentration of molecules are the SAME on both sides of the cell
membrane, the solution is *
A. Hypertonic
B. In equilibrium
C. Hypotonic
D. Kinetic

Answers

Answer:

isotonic: in equilibrium.

Explanation:

tonicity is the relative concentration of solutes dissolved in solution which determine the direction and extent of diffusion. if let's say sodium is the same both inside the cell membrane and outside the cell membrane then it is isotonic in equilibrium.

What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4

THESE ARE THE OPTIONS

2,3,4, -5

O 2a, 3b, 4c

-5a, 8

2a, -5a, 8, -4


HELPP

Answers

Answer:

2a and -5a

8 and -4

hahahah they are separate from each other

2a and -5a simplifies to -3a

8 and -4 simplifies to 4

Explanation:

hope this helps!

A cell membrane is called _____________ because it allows only certain substances to enter and leave the cell *

a. exocytosis
b. endocytosis
c. semipermeable
d. diffusion

Answers

The answers is semi permeable hope this helps

Do all rocks folow the same path through the rock cycle? Explain.

Answers

Answer:

There are three different types of rocks: sedimentary, igneous, and metamorphic. Each of these different kinds will have their own, distinct rock cycles. Thus, it's false to say that all rocks follow the same pathway.

heres ur answer<3

The workers who paid a rate for every day they work are known as

Answers

Answer:

piece work

Explanation:

I hope this is right

How is earth like a system

Answers

Answer:

Earth is a dynamic planet; the continents, atmosphere, oceans, ice, and life ever-changing, ever interacting in myriad ways. These complex and interconnected processes comprise the Earth system, which forms the basis of the scientific research and space observation that we refer to as Earth system science.

Explanation:

Is energy used or not?

Answers

Answer:

Explanation:

energy is used, everything uses energy especially living organisms

Answer:

Yes energy is used, it can be used in certain ways, like when you are running or walking, guess why you are able to do those because you have energy to do that.

Explanation:

The photo shows a student using email.
What is the main need or want this wave technology meets?
A. To hear and see others in real time
B. To efficiently communicate with others
c. To speak with and see others who are far away
O D. To efficiently store and share music with others

Answers

Answer:

B. To efficiently communicate with others

Explanation:

picture

Answer:

B

Explanation:

I'll give you brainliest if you answer my question.
Identify some changes in genetic traits that have occurred over several generations in an agriculture crop.
(ignore my name)

Answers

Answer:

Environment: All external conditions and factors, living and nonliving (chemical and energy), that affect an organism or other specified system during its lifetime.Generation: our step in the line of descent of a family / all the people born and living about the same time.Phenotype: An organism's physical appearance, or visible traits.Genotype: An organism's genetic makeup, or allele combinations.

The kind of changes with respect to the genetic traits that have occurred over several generations in an agriculture crop should be environment, generation, etc.

Changes in the genetic traits:

Environment deals with the external conditions and factors, that should be lived or non-lived also it impact an organism at the life time period.

While on the other hand, the generation should be the step with respect to the line of the family descent

Therefore, in this way, the changes should be considered.

learn more about traits here: https://brainly.com/question/18999457

In a certain plant, yellow leaves are dominant (Y) and red leaves are recessive (y). Plant with genotype Yy and a plants with yy crust. If they have for offspring how many would you predict would have red leaves? (Hint: draw a punnett square to help you determine the answer)

Answers

Answer: 1

Explanation:

a p e x

Answer:

1

Explanation:

Jimmy explained on his biology test that organisms grow because their cells grow. Explain why his answer is either right or wrong and if he is
wrong explain how organisms actually grow.

Answers

Answer:

See the answer below

Explanation:

Jimmy was right to say organisms grow because their cells grow.

The growth of organisms can happen in terms of an increase in the number of cells they have (through mitotic cell division) or an increase in the volume of the cells with or without an increase in the number of cells.

A good example is found in plants, most of which undergo an increase in size without any increase in the number of cells in their bodies. The uptake and storage of water in the vacuole produces a pressure that pushes on the cell walls, causing an increase in length, girths, and other growth features of the cells of plants.

Other Questions
what is y=x/2 but on a t table Your not my momnow say it in spanish? Carefully study the map above. Which of the following cities are labeled correctly?letter A Enidletter B Oklahoma Cityletter C Stillwaterletter D LawtonA. B and C onlyB. A, B, and C onlyC. B, C, and D onlyD. A and D only A customer paid 9x + 11y dollars for a bag that contains x pounds of chocolate and y pounds of almonds.Which statements about the expression are true?Select the three statements that are true.The amount the customer paid, in dollars, for the chocolate in the bag is 9x.O The amount the customer paid, in dollars, for the chocolate in the bag is 11y.The total weight of the bag of chocolate and almonds is 9x + 11y.The total weight of the bag of chocolate and almonds is x + y.The cost per pound of the chocolate is $11.The cost per pound of the almonds is $11. A company rents out 16 food booths and 23 game booths at the county fair. The fee for a food booth is $100 plus $9 per day. The fee for a game booth is $95 plus $5 per dat. The fair lasts for d days, and all the booths are rented for the entire time. What is the simplified expression for the amount, in dollars, that the company is paid. Write an equation of the line that passes through (0,5) and (4,5). plssss Do you believe that global warming is happening? Tell why or why not. If you believe global warming is happening, what can we do to slow it down? What is design reference threat PLEASE HELP ME ON THIS Write an equation of a line in slope-intercept form with the given slope and y-intercept. slope: 2/3, y-intercept: 5 how do people help millions 100 millions of people? 99 points for answering Supported taxes on goods brought into the country Believed in the rights of the common man Opposed slavery 16-2k=14. what is the value of k The residents of a city voted on whether to raise property taxes. The ratio of yes votes to no votes was 5 to 7. If there were 6936 total votes, how many no votes were there? Which theme is most typical of a creation story?A. a traveler takes a long, dangerous journey.B. stealing fire from gods never ends well.C. war and peace make up a never-ending cycle.D. curiosity leads to the loss of something pure. Why does Krakauer cite these letters? How does citing them add to or detract from the text? Which pair of numbers is relatively prime?A 7 and 21 B 4 and 15 C 6 and 9 D 9 and 27 The more you try to be someone else, the less time you have to try to find yourself. Write a paragraph of at least 7-10 sentences about your favorite hobby. Who is Circe?A. an enchantressB. one of the lotus eatersC. a giantD. a cannibalE. guard of the cattle