For whom did Swift write?
the English
the Tories
the Whigs
the Protestants
hw questioned

Answers

Answer 1

Answer:Swift wrote for the Whigs. Mr. Jonathan Swift was an Anglo-IRissh essayist and political pamphleteer. He wrote for the Whigs first, then followed by for the ...

Explanation:


Related Questions

What is the purpose of monologue?
O to quickly share a speaker's thoughts without other characters hearing
O to disclose a speaker's thoughts quietly to the audience
O to express a speaker's innermost thoughts only to themselves without other characters engaging or responding to
their words
• to reveal their thoughts and emotions to the audience and characters through a moving speech that builds to a
climax

Answers

The purpose of monologue is to reveal their thoughts and emotions to the audience and characters through a moving speech that builds to a climax.

What is monologue?

Monologue is defined as a type of speech that is performed by a character in a play before the audience which is usually extended.

The main reason for this speech is to reveal one's thoughts and emotions usually through moving speech that builds to a climax.

Learn more about speech here:

https://brainly.com/question/26157848

#SPJ1

Answer:

D. to reveal their thoughts and emotions to the audience and characters through a moving speech that builds to a climax

William is writing a research question to drive his study about the difference between the USDA's recommendations regarding the consumption of dairy products and current research on the subject.

Which question is most effective for guiding William's research?

A.
How does the USDA work with researchers to update their recommendations to the public regarding dairy product consumption?
B.
Who does the USDA consult in the research community when considering whether to change their guidelines concerning dairy product consumption?
C.
Why do the USDA’s current recommendations regarding the consumption of dairy products contradict current research findings?
D.
How often does the USDA apply current research findings to update their guidelines concerning the consumption of dairy products?

Answers

The question is most effective for guiding William's research is why do the USDA’s current recommendations regarding the consumption of dairy products contradict current research finding.

What is research question?

Research question are asked to help guide research, this are question to answer when doing research and the results of the research help answer the question.

Therefore,

The question is most effective for guiding William's research is why do the USDA’s current recommendations regarding the consumption of dairy products contradict current research finding.

Learn more on research below

https://brainly.com/question/968894

#SPJ1

Answer:

C.

Why do the USDA’s current recommendations regarding the consumption of dairy products contradict current research findings?

Explanation:

Just did it

In this excerpt, the Dillingham Youngs are described as a couple that
.

Answers

In this excerpt, the Dillingham Youngs is described as a couple that follows a daily routine.

Who are the characters in the story "The gift of the Magi"?

There are three famous characters through which the whole story surrounds. They are Della Dillingham Young, her husband Jim Dillingham Young, and Madame Sofronie who is the minor character in the story.

The options under this question are:

enjoys fancy mealsfollows daily routineenjoys living in the citypractices religion

This story features a young husband and wife and their scrabble to purchase Christmas gifts for each other with very little money. According to the excerpt of the story "The gift of the Magi" both of them are described as a couple that has a certain daily routine.

Thus, the correct option for this question is B, i.e. follows daily routines.

To learn more about "The gift of the Magi", refer to the link;

https://brainly.com/question/20384831

#SPJ1

I didn't tell him the

Answers

Answer:

you didn't tell him the what??

Explanation:


1. The queen knew that she would be the only pretty woman at the party.

Answers

In the given sentence, the queen knew that she would be the only pretty woman at the party signifies the part of speech i.e. adjective.

What does part of speech mean?

Part of speech may be defined as a conventional class of terms differentiated according to the kind of idea represented and the operation performed in a sentence. There are eight types of parts of speech.

The complete question is: Identify the part of speech in the sentence "The queen knew that she would be the only pretty woman at the party".

The word pretty in the given sentence classified it as an adjective form of parts of speech. But, it should be kept in mind that in a different context the same word is classified under adverb, verb, and sometimes a noun.

Therefore, it is well described above.

To learn more about Parts of speech, refer to the link:

https://brainly.com/question/13167679

#SPJ1

How does Alexander Hamilton’s letter support the way in which Lin-Manuel Miranda characterizes him in “Alexander Hamilton”?

Answers

Alexander Hamilton’s letter supported the way in which Lin-Manuel Miranda characterizes him in “Alexander Hamilton as it provides information about his Latin American experience.

Who is Alexander Hamilton?

It should be noted that Alexander Hamilton was an American revolutionary statesman as founding father.

Alexander Hamilton’s letter supported the way in which Lin-Manuel Miranda characterizes him in “Alexander Hamilton as it provides information about his Latin American experience.

Learn more about Alexander Hamilton on:

brainly.com/question/14111079

#SPJ1

Which line from Edgar Allan Poe's "Annabel Lee" contains alliteration?
Annabel Lee
by Edgar Allan Poe
It was many and many a year ago,
In a kingdom by the sea,
That a maiden there lived whom you may know
By the name of Annabel Lee;
And this maiden she lived with no other thought
Than to love and be loved by me.
/was a child and she was a child,
In this kingdom by the sea.
But we loved with a love that was more than love-
I and my Annabel Lee-
With a love that the winged seraphs of Heaven
Coveted her and me.
And this was the reason that, long ago.
In this kingdom by the sea,
A wind blew out of a chnud, chilling
My beautiful Annabel te
So that her highborn kinsmen came
And bore her away from me.
To shut her up in a sepulchre
In this kingdom by the sea.
The angels, not half so happy in Heaven,
Went envying her and me-
Yes!-that was the reason (as all men know,
In this kingdom by the sea)
That the wind came out of the cloud by night,
Chilling and killing my Annabel Lee.

Answers

Answer:

bsbsbajqajjs

Read the rough-draft paragraph.

Since popcorn is a whole grain, it is high in dietary fiber, which helps in the regulation and maintenance of the digestive system. To maximize the healthful benefits of eating popcorn, be sure to only munch on either air-popped popcorn or kernels that have been popped using little oil. In addition to providing dietary fiber, popcorn is also a source of antioxidants. This means that like fruits and vegetables, popcorn contains compounds that can reduce or prevent certain cancers. So, not only is popcorn a tasty treat, it is also a nutritional powerhouse.

Which topic sentence should be added to this body paragraph?

Foods loaded with fiber have been known to lower the risk of heart disease.
Recent studies prove that popcorn is one of the healthiest snack choices.
Antioxidants are sought after by many health-conscious people.
Air-popping and microwaving are two methods of preparing popcorn.

Answers

The answer choice which represents a possible topic sentence for the body paragraph is; Recent studies prove that popcorn is one of the healthiest snack choices.

Which topic sentence should be added to this body paragraph?

The body paragraph while discussing the dietary fiber content of popcorn also indicates that popcorn is a rich source of antioxidants. Hence, a suitable topic sentence would be; Recent studies prove that popcorn is one of the healthiest snack choices.

Read more on topic sentence;

https://brainly.com/question/3459976

#SPJ1

what figure of speech is this expression whose face is engraved the stark of life​

Answers

A Metaphor is a figure of speech that is mentioned in a statement whose face is carved with the harshness of life.

What is the definition of a figure of speech?

A type of language (like a simile or metaphor) that is used to transmit meaning or heighten the effect by comparing or associating one item with another that has a meaning or connotation that the reader or listener is familiar with is referred to as a figure of speech.

Thus, in the above statement figure of speech used is a metaphor

Learn more about Figure of speech:

https://brainly.com/question/12645975

#SPJ1

Select the correct answer.
Which set of words best describes the woman's character?
A.
energetic, attractive, friendly
B.
worried, shy, intimidated
C.
independent, eccentric, nervous
D.
lonely, languid, desperate

Answers

Answer

A! I think its A cus the other ones dont seem right..

Explanation:

Good morning guys how are you please help me this question

Answers

1. E
2. A
3. G
4. D
5. B
6. F
7. C

Pretty certain that’s right.

Which sentence should appear first in an effective summary of Part 2 of "The Adventure of the Blue Carbuncle"? The owner of the hat, Henry Baker, pays a visit to Holmes after spotting the advertisement in the newspaper. Holmes and Watson learn from the innkeeper the goose was purchased from a market in Covent Garden. Holmes and Watson visit the innkeeper who sold the goose to Baker. Holmes and Watson set out to find the salesperson at Covent Garden.

Answers

The sentence that should appear first in an effective summary of Part 2 of "The Adventure of the Blue Carbuncle" is A. The owner of the hat, Henry Baker, pays a visit to Holmes after spotting the advertisement in the newspaper.

What is summary?

It should be noted that summary simply means a concise information about a particular happening or event

In this case, the sentence that should appear first in an effective summary of Part 2 of "The Adventure of the Blue Carbuncle" is that the owner of the hat, Henry Baker, pays a visit to Holmes after spotting the advertisement in the newspaper. This is important for the text sequence.

Learn more about summary on:

brainly.com/question/25950911

#SPJ1

Answer:The sentence that should appear first in an effective summary of Part 2 of "The Adventure of the Blue Carbuncle" is A. The owner of the hat, Henry Baker, pays a visit to Holmes after spotting the advertisement in the newspaper.

Explanation:

adapted excerpt from Cats: Their Points and Characteristics
by W. Gordon Stables

“Are cats to be trusted?”

A question like this, which to kitty is a most momentous one, affecting not only her comfort and happiness, but her standing as a social pet and her very existence itself, cannot be treated lightly in a work like mine. My own opinion is, and always has been, that if cats are properly fed and cared for, they will do anything rather than steal. However, I was not content with providing just my own experience in this volume, since some might say my cats have been exceptional. Instead, I placed cats in court, as it were, and given them a long, fair, and impartial trial. For several months, I have summoned evidence for and against cats’ honesty from people all throughout Great Britain and Ireland.

Based on the information my participants provided, the verdict is as follows: “cats are not as a rule thieves, but in fact, quite the reverse.” In most cases, when properly treated, cats are to be trusted.

Which sentence in the writer’s essay should be revised to include an in-text citation?

While many might disagree, I believe cats are the best pet of all. Some insist that dogs are better companions because they are more reliable and well-behaved. However, cats don’t necessarily deserve their negative reputation. Based on a survey of cat owners throughout Great Britain and Ireland, most cats do not steal food if the humans around them take good care of them.

Answers

The sentence in the writer’s essay that should be revised to include an in-text citation is However, cats don’t necessarily deserve their negative reputation.

What is an excerpt?

An excerpt refer to words , Statements, ideas or phrases that is extracted from a literature which has meaning.

Therefore, The sentence in the writer’s essay that should be revised to include an in-text citation is However, cats don’t necessarily deserve their negative reputation.

Learn more about excerpt below.

https://brainly.com/question/21400963

#SPJ1

a piece of reasoning in the text

suggesting how a specific example relates to the broader argument

What does Odysseus tell Penelope and why is it ironic?

Answers

You would need to be more specific for a good answer. But I’ll take a shot in the dark and say you are talking about when Odysseus tells her he must leave again after just arriving in Ithaca. It’s ironic because the whole book was about getting home, and showed how much Odysseus missed his home, just for him to leave as soon as he arrived.

3 4 ASSESS YOURSELF Fill in the blanks choosing correct word from bracket. 1. There are lots of here. (shop, shops) 2. These are really slow. (bus, buses) How many does he have? (wife, wives) 4. The of horses are very strong. (hoof, hooves) 5. These over there run very fast. (calf, calves) 6. I like to swim if the ___________ aren't too big. (wave, waves) 7. She always brings lots of_________ with her. (toy, toys) 8. I fill my three with water. (bucket, buckets) 9. These are from the next village. (sheep, sheeps) 10. Her_________ are very smooth. (hair, hairs) 11. How many of chalks do you have? (piece, pieces) 3.​

Answers

Answer:

1. shops, buses, wives, hooves, calves, waves, toys, buckets, sheeps, hair, pieces

Explanation:

Answer:

answers highlighted in green

go to the movies tonight?
A) How about
B) Why don't we
C) What about
D) Let's
A

Answers

B)Why don’t we go to the movies tonight?

Grammatically correct the sentence Learned how to download the correct internet browser

Answers

The grammatical correct sentence is, 'Learn how to download the correct internet browser'.

What is grammatical errors?

Grammatical errors, are the errors in English, is the wrong use of grammar when writing a sentence.

For example, wrong use of tense, or preposition or adverb, etc.

Thus, the grammatical correct sentence is, 'Learn how to download the correct internet browser'.

Learn more about grammar

https://brainly.com/question/1952321

#SPJ1

After reading a passage, what might be a good way to make sure you understand what you have read?
a.
reread the passage until you understand
c.
locate key words
b.
share with someone
d.
create a graphic organizer in an easy reference format

Answers

Answer:

d.

create a graphic organizer in an easy reference format

Explanation:

It will be in easy reference format so you can look at it when you need it

I reproached the wall; I replied to the yells of him who clamoured . What due the wyd clamoured likely mean in the sentence?

Answers

Answer:

Can you ask that again?? this really didn't make sense.

Explanation:

in which location would you most likely find a print source?

Answers

Answer:

C

Explanation:

C at store magazine rack

Read the dialogue between Romeo and Mercutio found in Act I, scene iv of Romeo and Juliet.

Romeo: Give me a torch: I am not for this ambling;
Being but heavy, I will bear the light.

Mercutio: Nay, gentle Romeo, we must have you dance.

Romeo: Not I, believe me: you have dancing shoes
With nimble soles; I have a soul of lead
So stakes me to the ground I cannot move.

Based on these lines, which statement is true?

Romeo is unhappy, and Mercutio is upbeat.
Romeo is upbeat, and Mercutio is unhappy.
Romeo is nervous, and Mercutio is brave.
Romeo is brave, and Mercutio is nervous.

Answers

We can actually deduce here that based on the given lines above, the statement that is true is: Romeo is unhappy, and Mercutio is upbeat.

What is Romeo and Juliet?

Romeo and Juliet is a play that was authored by William Shakespeare. The play reveals how Romeo and Juliet fell in love with each other even when their families were at rancour.

We see that the given lines show that Romeo is unhappy here. Romeo stated that he is not for this ambling and wasn't in the mood to dance.

Learn more about Romeo and Juliet on https://brainly.com/question/10714446

#SPJ1

Answer: B)  Romeo is upbeat, and Mercutio is unhappy.

Explanation:

Hope this helps!

Mark me brainliest!

Pls and TY!

WILL MARK BRAINLIEST AND 50 POINTS!!
Can somebody write an essay for me for Writing an Essay to Compare the Presentation of Ideas across Genres
Here's the prompt
Award-winning author Sonia Nazario is best known for her Pulitzer Prize–winning biography Enrique’s Journey. The book brings to life the very real and dangerous journey of a Honduran boy fleeing his home in hopes of finding his mother in America. In addition to the biography, Nazario has written countless articles informing readers of the dangers children like Enrique face. While the biography and the articles serve the same purpose and present the same ideas, they do so in different ways. You will be comparing and contrasting how Nazario informs her audience through a biography and an editorial. You may access the editorial here and the biography here.

Write a comparative essay in which you compare and contrast the way Sonia Nazario presents similar ideas in a biography and an editorial. Support your comparison with well-chosen, relevant, and sufficient evidence from both texts. Apply MLA guidelines to properly cite the evidence used in your essay. Be sure your essay uses formal and objective language.

Answers

The biography Enrique's Journey tells how this one boy made his journey to America.

How to depict the essay?

The biography was that he lived and had to try to survive, just to have a better life. He scratched to get to America and at one point, on a train, he was introduced him to other bad people. Nazario claims that when he was deported, he always stuck with one of these members to protect himself from any attacks.

The editorial, also written by Nazario, mostly shows objective facts obtained from studies, not just one perspective as it tells how almost 7,000 children were picked up by Immigration officers three years before the article was written.

Learn more about essays on:

brainly.com/question/24799048

#SPJ1

in the first question in Beowulf, which part is most clearly the rising action

Answers

In the first section of this story, the rising action is the attack of Grendel on Heorot.

What is the rising action?

This refers to events in a story that later lead to the main conflict or the climax of the story.

What is the rising action in Bewoulf?

In this story, the rising action is the first time Gredel attacks the people. This is because this event is the one that leads to the main conflict between Bewoulf and the monster and therefore this event triggers the climax or conflict of this story.

Learn more about rising action in: https://brainly.com/question/2180986

#SPJ1

Ram said to me,"where are you going now."into indirect speech

Answers

Answer:

the ram asked where i was going then

Which rhetorical appeal does Murray use MOST effectively (logos, pathos, or ethos)? Give at least one example from the essay to prove your answer.

Answers

The author of the article uses pathos which is a rhetorical appeal to emotions.

What is the rhetorical appeal?

Rhetorical appeals refer to the qualities of an argument that make it truly persuasive.

The author of the article majorly uses pathos as a rhetorical appeal to the emotions.

Murray resorts to the descriptive and figurative language, powerful connotative words like emotional diction with a number of rhetorical questions and phrases.

Learn more about Rhetorical appeal here:

https://brainly.com/question/19264317

#SPJ1

In your opinion, did Whitman's use of free verse in "Song of Myself" help him to connect with his readers? Give reasons for your answers. Your response should be at least 150 words.

Answers

Answer:

yes I do believe that Whitman's use of free verse in "Song of Myself," helped him to better connect with his readers. Whitman's use of free verse enables him to talk to his readers in a new way that is not constricted by rhyme or meter parameters. Also, his use of language sounds more like spoken language and helps readers to not only understand what he is saying, but also to better connect with the complex and emotional themes that Whitman was discussing in "Song of Myself." More than one hundred fifty years later, the themes he uses in "Song of Myself," as well as his exciting use of language still speaks to a new audience in a new generation, which shows how well thought out and carefully pieced together his poetry was, and I believe that the use of free verse aided significantly in Whitman's ability to make the poem into exactly what he wanted it to be.

Yes, I believe Whitman's use of free verse in "Song of Myself" helped him connect with his readers better. Whitman's use of free verse allows him to communicate with his readers in a way that is not limited by rhyme or meter parameters.

Who was Whitman?

Walter Whitman Jr. was a poet, essayist, and journalist from the United States. He was a humanist who participated in the transition between transcendentalism and realism, incorporating both perspectives in his works.

His use of language sounds more like spoken language, which helps readers not only understand what he is saying, but also connect with the complex and emotional themes discussed by Whitman in "Song of Myself."

More than one hundred fifty years later, the themes he uses in "Song of Myself," as well as his exciting use of language still speaks to a new audience in a new generation, which shows how well thought out and carefully pieced together his poetry was.

Therefore, I believe that the use of free verse aided significantly in Whitman's ability to make the poem into exactly what he wanted it to be.

To learn more about Whitman, click here:

https://brainly.com/question/1534324

#SPJ2

our hamburgers (be)so tasty!

Answers

Answer:

our hamburgers are so tasty!

"Our hamburgers are so tasty!" The verb "are" is the correct form of "to be" to complete the sentence.

In this sentence, the subject "our hamburgers" is plural, referring to more than one hamburger. When the subject is plural, the corresponding form of "to be" is "are." The use of "are" indicates that the hamburgers possess the quality of being tasty.

This sentence expresses a positive statement about the deliciousness of the hamburgers. Proper subject-verb agreement is essential in English grammar to ensure that the sentence is clear and grammatically correct. In this case, "are" matches the plural subject "our hamburgers" to create a coherent and accurate sentence.

To know more about verb , click here.

https://brainly.com/question/14574299

#SPJ2

------------The given question is incomplete, the complete question is:

"Complete the sentence with the correct verb for(to be)

- Our hamburgers_(be) so tasty!"------------

If any of the underlined segments has an error, select the answer option that IDENTIFIES the error. If no segments have an error, select "No error."
Bill, who has been my best friend since kindergarten, just married a woman, he met during his travels in Indonesia.

Answers

There is an error in the sentence, the punctuation comma is not suppose to before he met.

The correct sentence is Bill, who has been my best friend since kindergarten, just married a woman he met during his travels in Indonesia.

What is sentence error?

Sentence error refer to mistakes that occur when written a sentence and this can alter the meaning and the sentence structure.

Therefore, There is an error in the sentence, the punctuation comma is not suppose to before he met.

The correct sentence is Bill, who has been my best friend since kindergarten, just married a woman he met during his travels in Indonesia.

Learn more about sentence error below.

https://brainly.com/question/383301

#SPJ1

Choose the correct chronological order of the time periods. 1 fall of the roman empire /\ 2 Gregory I becomes pope /\ 3 height of the medieval period /\ 4 Fall of the roman empire

Answers

The correct chronological order is as follows:

Fall of the Western Roman Empire.

The Western Roman Empire fell in in 476 AD.

Gregory I becomes pope.

Gregory I becomes pope in 590 AD.

Height of the medieval period.

The medieval period peaked around 1000 - 1300 AD, or 1150 AD if you take the mean.

Fall of the Eastern Roman Empire.

The Eastern Roman Empire, or the Byzantine Empire, fell at 1453.

~

Learn more about the Roman Empire (West & East):

https://brainly.com/question/11415671?referrer=searchResults - The different churches followed by the respective halves of the empire.

https://brainly.com/question/20369245?referrer=searchResults - The result of moving the capitol to Byzantine, away from Rome.

what do max and sarai have in common commonlit( the night oak street burned down)

Answers

The inference shows that the thing that Max and Sarai had in common was that they both witnessed how their house got burnt.

What is an inference?

An inference simply means the conclusion that can be deduced based on the information given in a story.

In this case, the inference shows that the thing that Max and Sarai had in common was that they both witnessed how their house got burnt. This was a result of the power outage and loss of cell phone signals.

Learn more about inference on:

brainly.com/question/25280941

#SPJ1

Other Questions
If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain. A chemical reaction can be reversed if?The energy of the reactants exceeds the activation energy threshold.The energy of the products exceeds the activation energy threshold.The energy of the reactants is less than the activation energy threshold.The energy of the products is less than the activation energy threshold. Miguel Rodriguez borrowed $300 from his brother Julio to pay for books and tuition. He agreed to pay Julio in 6 months with simple annual interest at 6.9% Someone please help fast!Simplify: in the picture Choose the correct verb in subjunctive and complete the following sentences.Espero que sean/conozcan las pirmides de Egipto What is f(x) + f(x) + f(x)? 3f(x)3f(x) = 3xEvaluate 3f(2) = .