(For people who need help but can't find it or people who need a break)
This is a sign. You have been over worked. You are obviously stressed out. You need a break. You need help. Just calm down. Relax. Let your shoulders drop. Let your eyes relax and close. Breath. Just breath for a few seconds. Make your self a schedule to do all your work with breaks. You need some breaks. You will never be able to get your assignments done if you don't have enough energy. Now, Ask me your questions. I know its hard not being able to get the right answers from this app. You just need to breathe. Maybe I can answer your questions. Your going to get your assignments done. You going to get passing grades. Your going to be okay. Just ask me your questions

Please only answer if you need help, I don't want answers to he taken away from burnt out kids who need help. Please, You have no questions, Just leave. ​

Answers

Answer 1

Answer:

Amen to that!!!

Answer 2

Answer: Oh my gosh you just made my day 100,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,00,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000 times better!!

Explanation: I was getting stressed out with my broken hand and I read this and now I am practically half asleep now... ZZZ...ZZZ...ZZZ...ZZZ...ZZZ...ZZZ


Related Questions

Which of the following is NOT considered a body weight exercise?
lunge
plank
dip
bicep curl

Answers

Answer:

lunge

Explanation:

The plank see's how long you can hold your body weight for, similar to dip, and bicep curl. Lunge has never been a body weight exercise before, I know because I've done gym long enough to know what body weight exercises we do.

Answer: I know it’s 100 % not a dip or plank

Explanation:

who loves by broken dog lol

Answers

Answer:

meeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee

Explanation:

I do! They’re so cute!

>w<

Which one of the following is an appropriate and
professional part of your job?
A) Changing the client's care plan
B) Accepting tips from your client
C) Accepting gifts from your client
D) Calling your supervisor when you are not sure what to do

Answers

Answer:

The answer would be letter A

Name 3 skills necessary for maintaining reproductive health:

Answers

Answer:

Quit smoking. A single stick of cigarette contains countless toxic compositions that lead to addiction, cancer and coronary issues. ...

Go for regular screenings. ...

Practice safe sex. ...

Have regular orgasms. ...

Increase consumption of calcium and magnesium. ...

Final note.

Explanation:e

well im upset who cares emencho106 i rly wont leave u :( sry if u think that

Answers

Answer:

Hi. I’m here if you want to talk. Why so upset? I’m here to help

Explanation:

Answer:

wssp, lets talk in this one. Brainlets???

(20 points)
1. In an emergency, who should a caregiver call first?
A- Parent that usually picks up child
B- 911
C- Both Parents
D- Child's primary care physician

2. What is the first vaccination recommended from the CDC at birth?
A- Measles
B- Hepatitis B
C- Influenza
D- Varicella

Answers

well reasonably speaking B and B
B for sure and most likely B

Think of a situation that might emerge in health care where the patient’s wishes might disagree with the health care provider’s personal ethics. Describe the situations and explain what the healthcare provider should do in it.

Answers

Answer:

A situation that might emerge in health care where the patient’s wishes might disagree with the health care provider’s personal ethics and healthcare provider should do is explained below in details.

Explanation:

Health care leaders' conclusions must encourage stakeholders' different situations and improve population health. Choices must adhere to the second policy of non-maleficence, the responsibility to cause no infliction to patients, personnel, business, or community. ... Ethical difficulties occur within patients, payers, and providers.

Sweat on the surface of the skin can cause body odor.

True

False​

Answers

Answer:

True

Explanation:

The answer is true(I don’t know what it has to be 20 characters long)

warning 13+...

is my "thing" a good size ? it is currently 6.8 inches when fully erect im 14 and it doesnt seem like enough is it a good length and will it grow?

Answers

Answer:

lm.ao ur wild bro

Explanation:

Which of the following equations best represents a 15 year olds lower part of their target heart rate zone?

Answers

Answer: 103

Explanation:

Hanami has a 56 weight and 1.56 meter in height what is her BMI




HELP ME PLEASE !​

Answers

Answer:

her bmi is 23

Explanation:

kg/m^2 plug in numbers 56/1.56^2

can any one give answer! difference between aerobic respiration and anerobic respiration​

Answers

Answer:

Aerobic respiration uses oxygen, while anaerobic does not.

Explanation:

Aerobic respiration is used when cells have access to oxygen and can use it, but if a cell is in a place that oxygen is not available anaerobic respiration is used instead.

Red meats, fried foods, and some dairy products are high in
fats.

Answers

Answer: yes

Explanation:

Answer:

nice

Explanation:

mutual monogamy removes all the chances of a person contracting and std/sti
a. TRUE
b.FALSE

Answers

False it is not true even if you have mutual monogamy you can still get it
false.
i agree with the person above

How can parents help improve their child’s perception

Answers

Answer:

by being in the childs life (being their for them)

Explanation:

The impact of parents may never be greater than during the earliest years of life, when a child’s brain is rapidly developing and when nearly all of her or his experiences are created and shaped by parents and the family environment. Parents help children build and refine their knowledge and skills, charting a trajectory for their health and well-being during childhood and beyond.

Theprovides the brain physical protection from traumatic injury.

Answers

Answer:

A TBI can result in short or long-term problems with independent function). The brain is housed inside of a bony covering called the cranium. The cranium protects the brain from injury and along with the bones that protect the face are called the skull.

Explanation:

I hope this helps! Good Luck! ;)

Answer:

The brain is housed inside of a bony covering called the cranium. The cranium protects the brain from injury and along with the bones that protect the face are called the skull.

Explanation:

What desire might lead a person to develop anorexia? Choose the best answer.

A desire to be perfect

A desire to scare his or her parents and friends

A desire to be unhealthy

A desire to be severely underweight

Answers

a desire to be perfect

Answer:

A desire to be perfect

Explanation:

Explain in your own words how to convert 0.25 to a fraction. Be sure to give the answer. *

Answers

Answer:

1/4

Explanation:

You dont have a full dollar but only 25 cents so 4 quarters make a dollar right?

You only have 1 quarter so you have 1/4

To convert a decimal to a fraction, we can put the number over 100. In this case, 0.25 would be put over 100.

[tex]\frac{25}{100}[/tex]

Then, you reduce the fraction. Since 25 goes into 100 four times, your fraction is now

[tex]\frac{1}{4}[/tex]

~theLocoCoco

20 POINTS GIVEN!!!!!!!!!!
Hey! I need help!! SUPER URGENT!!!! I think I broke my Finger!!!! DO YOU GUYS KNOW WHAT TO DO? I DON'T WANT TO GO ANYWHERE!!! I NEED A AT-HOME-SPLINT OR SOMETHING!!! WILL GIVE 20 POINTS!!!!!!

Answers

1) Tape (whatever you have on hand),

2) Gift card (whatever you have on hand, preferably one that is empty).

3) Cotton, gauze or some sort of padding to prevent a blister.

Cut two pieces of tape long enough to wrap around the finger and splint at least 1½ times.

Mold the Card to Wrap Around the Finger

Add Padding Put the cotton, gauze or some sort of padding between the finger and the splint.

The Splint Put the card around the padded finger.

Tape Wrap the tape around the finger and card in 2 places.

Note:  The Tape should not be wrapped too tightly, otherwise your finger will become numb.  If you notice any funny sensations in your finger then unwrap the tape and wrap the tape more loosely.

(please eventually see a doctor tho)

Which of the following phrases BEST describes structured exercise? A. flexible, changing B. intense, competitive C. organized, follows a pattern D. competitive, flexible

Answers

Answer:

C. organized, follows a pattern

Explanation:

Structured exercise is exercise that is performed with an underlying purpose and goal. Hence the word "structured" in structured exercise

Answer:

C. organized, follows a pattern

Explanation:

i got i right

will give brainliest to correct answer
which statement sums up the process of ovulation
The sperm penetrates the egg membrane and they fuse together
the egg attaches itself to the lining of the uterus
an egg rises from the ovary and travels down the fallopian tube
the egg starts to devide quickly

Answers

Answer:

the egg attaches itself to the lining of the uterus

Explanation:

an egg rises from the ovary and travels down the fallopian tube.

The success of a personal fitness program has to do with
attitude.
commitment.
adherence.
all of the above.

Answers

All of the above I think

I need Help!!! I will fail!! I will Mark you brainliest!!
I will report you if you give a false answer.
I need 3 paragraphs. This is the prompt:
Malorie desperately wants to lose weight. She has been experimenting with fad diets and skipping meals with no success. Explain to Malorie what a healthier and more successful way to lose weight would be.

Answers

Explanation:

A more healthier and successful way for Malorie to lose weight is a calorie deficit. Calorie deficiency is when a person eats less calories then they burn. This way, you will lose weight healthier. And you will not gain it all back.

Another way to lose weight is to eat in moderation. Moderation is key to lose weight. You should be happy when you are losing weight. You shouldn't eat stuff you don't want to. Eating in moderation means that you can eat whatever you want but in small amounts or occasionally. For example, you can eat pizza but for once a month. Or, you can eat chocolate but small amounts. Also, avoid sugary drinks and keep hydrated by water.

The last reason to lose weight successfully and healthy is to NOT starve yourself. According to the normal adult, they should be eating 3 meals and a few snacks a day. Starving can cause an ED and lead to many more health complications like organ failure. Do not binge or starve. Starving is bad because in the end, you will not feel happy and will gain a lot of your weight back. Instead, when you really want to snack on something you can try low calorie snacks not including veggies and fruits.

In conclusion, the 3 reasons Malorie can use to lose weight is going into a calorie deficit, eating in moderation, and not starving/ binge eating.

ive been up for 16 hours im dying

Answers

Then sleep it not hard

what are the major scopes of demography. Any two​

Answers

Answer:

The true scope of demography relates to whether it is a micro or macro study. Micro Demography: Micro demography is the narrow view of population studies. Among others, Hauser and Duncan include the study of fertility, mortality, distribution, migration, etc.

Explanation:

HELP ASAP multiple question right answer only!! (not all of the above)​

Answers

Answer:

A.

Explanation:

I don't think that there really are such things as Female condoms >w>

And I am pretty sure that You still can get them ever while using condoms

Answer:

The answer is all of the above, when they're refering to female condom's I feel they're most likely refering to woman x woman sex so therefore the female condom's would be something like finger condoms. Abstinence is a way to prevent it yes, but other birth control options are also great methods to stop the spread of STD's. Which is why it's all of the above.

Explanation:

Patrick is jumping rope to training for his next boxing match. He learned the correct way to jump rope when he was a member of his ‘s wrestling team. Which training principle does this scenario represent?

Answers

That he is doing jumping rope to training for his next boxing match

Which of the stretches can be harmful?

Head circles

Tricep stretch

Quadricept stretch

Achilles tendon stretch

Answers

Pretty sure it could be head circles because your neck is really delicate and if something happens, you could get seriously hurt or disabled from moving. (Sorry if I’m wrong, I’m no doctor)

Explain the importance of primary health care​

Answers

Answer: The main role of primary health care is to provide continuous and comprehensive care to the patients. It also helps in making the patient available with the various social welfare and public health services initiated by the concerned governing bodies and other organizations.

Explanation:

BRAINLESS PLEASE

Worth 10 or 13 points!! Does Sofie Dossi have a spine








trick question

Answers

Answer:

Yes she is just REALLY flexible!

Explanation:

LOL! like this question tho! :)

Since Sofie Dossi is a gymnast as well as she has a flexible body, it is clear that she have a spine.

The human brain and the rest of the body are connected by a column of nerves called the spinal cord, which gives you control over how you move. You couldn't move any part of your body without a spinal cord, and your organs couldn't work without one too.

For this reason, maintaining a healthy spine is essential if you wish to lead an active lifestyle.

In order to encourage nerve cell regeneration or enhance the functionality of the nerves that remain after a spinal cord injury, researchers are constantly developing novel therapies, including prostheses and drugs.

To learn more about spinal cord, click:

https://brainly.com/question/15708841

#SPJ6

Other Questions
A man travels 320 miles in 8 hours. If he continues at the same rate, how many miles will hetravel in the next 2 hours? what is the largest prime number? what should be added2x ^3+ 3x^2+8x-4to get 0 ? pls help asap! This homework is really hard what is the meaning of zest Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true