Find the value of x in the isosceles triangle

Find The Value Of X In The Isosceles Triangle

Answers

Answer 1

Step-by-step explanation:

Since all 3 sides of the triangle is equal, it is not only an isosceles, but an equilateral triangle.

x = 8sin60° = 6.928 or sqrt48.

Answer 2

That is a question about triangles.

In my answer I will show 2 ways to solve that question, ok? Let's go.

First way - Pythagoras's theorem

The line segment x divide the biggest triangle in 2 equals right triangles.

Let's choose one of them and note that is a triangule with hypotenuse equals to 8 and one cathetus equals to half of 8.

The Pythagoras's theorem says that:

[tex]\boxed{a^2 = b^2 + c^2}[/tex]

a is the hypotenuse and b and c are cathetus.

So, in our case, we know the hypotenuse and one cathetus, let's substitute that in the expression:

[tex]a^2 = b^2 + c^2\\8^2 = 4^4 + c^2\\64 = 16 + c^2\\c^2 = 64 - 16\\c^2 = 64 -16\\c^2 = 48\\c = \sqrt{48}\\c= 4\sqrt{3}[/tex]

Therefore, the value of x is [tex]4\sqrt{3}[/tex].

Second way - The equilateral triangle height

That way to solve the question is a consequence of the previous way.

That triangle has all the sides equals, so it is a equilateral triangle.The line segment x is the height of that triangle. And we can find the equilateral triangle height using that expression:

[tex]\boxed{h = \frac{S\cdot \sqrt{3} }{2} }[/tex]

h is the height and S is the triangle's side.

So, we know that the side of our triangle is 8. Let's change S value in the expression:

[tex]h = \frac{S\cdot \sqrt{3} }{2} \\h = \frac{8\cdot \sqrt{3} }{3} \\h = 4\sqrt{3}[/tex]

Thus, the value of x is [tex]4\sqrt{3}[/tex].

Note that in the 2 ways we find the same result, so that answer is correct.

I hope I've helped. :D

Enjoy your studies! \o/


Related Questions

also need help with this.

Answers

14a -ac = 8w - 6w
a(14-c) = 2w
a= 2w / 14 - c

Answer:

a = 2w/c/15

Step-by-step explanation:

14a = ac + 2w

ac + 2w + 14a = 0

ac + 14a = -2w

14a + a = -2w/c

15a = 2w/c

a = 2w/c/15

Which two properties characterize an air mass?

Answers

Answer:

Step-by-step explanation: Air masses are given a two-part name that describes the humidity and temperature characteristics of the region where they form

Answer:

Air masses have fairly uniform temperature and moisture content in horizontal direction (but not uniform in vertical).

Step-by-step explanation:

Looked it up

Can somebody plz help answer the missing terms correctly thanks so much!!

WILL MARK BRAINLIEST WHOEVER ANSWERS FIRST :DDDD

Answers

Answer:

Step-by-step explanation:

your mom

Answer:

9. 5

10. 3

11. 1

12. 7

13. 48

14. 24

15. 9

16. 6

Jennifer purchased for 2$ and p pounds of sliced turkey at 5$ per pound for a total of $13.25. Which equation represents jennifer's purchase from the grocery store?

Answers

Answer:

$2 + $5p = $13.25

Step-by-step explanation:

Given that:

Initial purchase = $2

Pound of sliced turkey = p

Cost per pound of sliced turkey = 5$

Total amount spent = $13.25

Jennifers purchase from grocery store :

Initial purchase + (pound of sliced turkey * cost or pound) = total amount spent

$2 + $5p = $13.25

Find the slope and the -intercept of the line. y=-1/5x+7 plz i need help

Answers

Answer:

slope= -1/5

y-intercept=7

Step-by-step explanation:

y=mx+b is a linear equation

m=slope

b=y-intercept

help me pass my class .

Answers

Answer:

about 3.6

Step-by-step explanation:

pythagorean theorem

sqrt 13

Write the expression-
The quotient of x and 8

Answers

Answer:

x ÷ 8

Step-by-step explanation:

The length of the two legs of a right triangle are 18 cm and 24 cm.
What is the length of the hypotenuse of the triangle?
O A. 30 cm
OB. 36 cm
OC. 42 cm
D. 48 cm

Answers

Answer: 30 cm

Step-by-step explanation: Take note that ^2 means to the second power.

a^2 + b^2 = c^2 (hypotenuse)

18^2 + 24^2 = c^2

324 + 576 = c^2

900 = c^2

To find the length of c you have to find teh square root of 900.

√c^2 = √900

c = 30

The length of the hypotenuse is 30 cm!

Hope this helped!

please help quick time

Answers

Answer:

[tex]Area = 34.2cm^2[/tex]

Step-by-step explanation:

Let the three sides be a, b and c respectively.

Such that:

[tex]a = 8[/tex]

[tex]b = 9[/tex]

[tex]c= 10[/tex]

Required

Determine the area

This is calculated as:

[tex]Area = \sqrt{s(s-a)(s-b)(s-c)[/tex]

Where

[tex]s = \frac{1}{2}(a + b + c)[/tex]

Substitute values for a, b and c

[tex]s = \frac{1}{2}(8 + 9 + 10)[/tex]

[tex]s = \frac{1}{2}(27)[/tex]

[tex]s = 13.5[/tex]

Substitute values for a, b, c and s in

[tex]Area = \sqrt{s(s-a)(s-b)(s-c)[/tex]

[tex]Area = \sqrt{13.5 * (13.5 - 8)* (13.5 - 9)* (13.5 - 10)[/tex]

[tex]Area = \sqrt{13.5 * 5.5* 4.5* 3.5[/tex]

[tex]Area = \sqrt{1169.4375[/tex]

[tex]Area = 34.2[/tex] -- Approximated

help please, 25 points! pythagorean thereom

Answers

Answer:

the pythagorean thereom is a^2 + b^2 = c^2

Step-by-step explanation:

to find the length of the hypotenuse use a^2 + b^2 = c^2 or b^2 + a^2 = c^2

but in order to find the length of the legs use c^2 - a^2 = b^2 or

c^2 - b^2 = a^2

Describe the end behavior of the following exponential function f(x)=3

Answers

Answer:

the correct answer would be the 2nd one !! please make me most brainlessly!!!

Quick Pleaseee helpp

When is substitution method easier to use than graphing method!!!!

Answers

Answer:

When you do not have a graph paper

or

one of the equations has an isolated variable

or

when the equations are not in slope intercept form

if g(x) = -3x +1 fill out the following table of values​

Answers

Answer:

-3 (-6)+1

18 +1

19

-3 (-2) +1

6 +1

7

-3(0)+1

0+1

1

-3(2) +1

-6 +1

-5

-3(6) +1

-18 +1

-17

Step-by-step explanation:

you plug in the numbers for x into the equation and solve, and that's the value that goes into the box below the number you just plugged in

The vertices of a triangle are (3,5), (-7,4) and (10,-2) then, what are the coordinates of the point of intersection of 3 medians of triangle? ​

Answers

Answer:

Step-by-step explanation:

Step 1: Identify the coordinates of each vertex. Step 2: Add all the x values from the three vertices coordinates and divide by 3. Step 3: Add all the y values from the three vertices coordinates and divide by 3. Step 4: Determine the centroid coordinate.

Write the point-slope equation of (1,6) (3,-6)

Answers

Answer:

0 (I think)

Step-by-step explanation:

(1,6) (3,-6)

X1 Y1. X2 Y2

-6-6= 0

3-1=2

0/2= 0

Answer:

y=-12/2x + -6

Step-by-step explanation:

m= rise/run = y2-y1/x2-x1

m=  -6 - 6 / 3 - 1    

m= rise/run  -12/2

Helppppl +13 points & +star

Answers

Answer:

hope it helps

Step-by-step explanation:

...........

Help and you shall receive 20 points

Answers

Answer:

its D   7 2/5

Step-by-step explanation:

What is the percent composition of Hydrogen in Acetone, C3H6O?
a, 62.0%
b, 10.4%
c. 27.5%
d. 19.9%

Answers

It’s c) I did this before I’m sure I’m sorry if it’s wrong
I think c (sorry if I’m wrong)

The trapezoid ABCD has bases AB = 15 and CD = 5, thigh AD = 9 and diagonal BD = 12. Find:

a) the height h

b) S

c) the perimeter P of the trapezoid

Please someone help me

Answers

Answer:

The height of the trapezoid is 6.63 units

The perimeter of the trapezoid is 38 units

Step-by-step explanation:

Whenever a geometry problem is given, it is often useful if it is sketched out. A sketch of this problem can be found in the image attached.

A)

We can see that a right-angled triangle is formed between points BED, with line BE being the height, h.

To get the dimensions of the line EB, we subtract the dimensions of DC from AB. This will give 15 -5 = 10

hence the dimensions of the righ angled triangle are

DE= h

DB = 12 (diagonal)

EB = 10

From Pythagoras' theorem,

[tex]h =\sqrt{12^2 -10^2}=6.63[/tex]

The height of the trapezoid is 6.63

B)

We can get the perimeter of the trapezoid by adding the dimensions of all four sides together.

This will be

AD + DC + CB + AB

However we can assume for this case that it is a symmetrical trapezoid, and hence AD = CB

Thus, perimeter =

2 (AD) + DC +AB

2(9) +5 +15 = 38.

The perimeter of the trapezoid is 38 units

In a rectangle or a rhombus: If ZP = 4x - 9 and PY = 2x +5, find x.
Please help ASAP!!!! Will give brainliest!!!

Answers

Answer:X=7

Step-by-step explanation:

Answer:

zp= 7,and py= 9

Step-by-step explanation

zp=7                  

(2)(2)+5

(2)(2)+5

py=9      

(4)(4)−9

(4)(4)−9

=7

If you were going to solve -3(x + 5) = 27, what is the first step that you would do? Why did you start there?

Answers

Answer:

Step-by-step explanation:

Multiply -3 for x and for 5

-3x-15=27

When you have this type of equation the first thing you do is take off the parentesis

Then you pass the 15 to the other side and you get -3x= 27 +15 . After that you divide that for -3 and you get the x . In this case x= -14

Sorry if the english is bad, i hope this helps

Question 1: In January, a puppy weighed 4kg.
Three months later, the same puppy weighed 5kg.
What was the percentage increase in the puppy's weight?

Answers

Answer:

sorry bro I didn't understand

Is -1 a solution to 4x - 3 < 5?
(look at the picture)

Answers

Answer:

Yes

Step-by-step explanation:

Assuming that the question is asking for -1 to be plugged in as x

4(-1)-3≤5

-4-3≤5

-7≤5

Elijah walked 6 miles in 3 hours.what was his walking rate in hours per miles?

Answers

Answer:

2 Miles per hour

Step-by-step explanation:

velocity (speed) formula is distance/time.

In this case, 6/3=2

Jon thinks of a number between 1 and 10.The cube of the number is equal to the square of double the number.What is number jon is thinking of?​

Answers

Answer:

4

Step-by-step explanation:

4^2=8 8^2=64

4^3=64

Jon is thinking about 4

Plz help find the perimeter and the are of the following show work plz

Answers

the picture isn’t loading in

Please help me It’ll help a lot

Answers

Answer:

heyy

the answers "20"

Step-by-step explanation:

Okay using the x that we have we find 40 and plug that into the graph and we have 20 :p

Wesley wants to have at least $50 to spend each day of his 7-day vacation. He plans to save $30 each month for 12 months. Which of the following shows that Wesley will save enough money for his vacation? Choose all that apply.

Answers

Answer:

i cant choose any that applies to this question because there is no picture added to it and there are no choices to choose from. If i were to solve it though, it would be; yes, he will save enough money for his vacation.

Step-by-step explanation:

I know he would have enough--and in this case more than enough, because since he's planning to save $30 for a whole year just for $50, when he could simply make $60--which is in fact more than needed for his goal-- in just 2 months. If he were to stick with his plan though, he'd make $360. I got that by multiplying 30 by 12.

Simplify the expression below.

5/8m + 9 - 3/8m - 15

Answers

Here you go I hope it’s right

Ronald bikes 6.9 miles each day. How far has Ronald biked in seven days.

Answers

that would be 48.3

Answer:

48.3

Step-by-step explanation:

6.9 times 7= 48.3

Other Questions
3. Study the changes in population graph, what % lived in cities by the 1930's?By the 1970's? What led the people of France to agree to an imperial dictatorship instead of a true democratic republic like the one selected in the American colonies? why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please which one is the right answer Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning. Please help me with this homework Different cities have different sales tax rates. Here are the sales tax charges on the same items in two different cities.Complete the tables. 50 points brainliest I'm watching to wait explain the difference between essential body fat and storage body fat which is true about the subject matter of an ode?a. it is usually a well-known object such as a monumentb. it varies greatly from famous people to ordinary objectsc. it is often something imaginary or mythicald. it tends to focus on an explored exotic places Find the amount of sales tax if the sales tax rate is 5% and the cost of the winter coat is $40. Hint: this question is only asking for the sales tax. I dont get- this thing .-. b.10 ftC3 ftarea of the rectangle =area of the triangle = In "House of the Scorpion", why can't they harvest El Patron's body? (plz quickly help meh due tomorrow)