Find the slope of the line (4,2) (-3,-2)

Answers

Answer 1

Answer:

m=4/7

Step-by-step explanation:

slope: y2-y1/x2-x1

Answer 2
The answer is m=4/7

Related Questions

Circle circumference
Will mark brainliest

Answers

106.76
47.1
43.96
these are the answers

What’s the equation of a line that is perpendicular to -x +2y =4 and passes through the point (-2,1)

Answers

Answer:

y = -2x - 3

Step-by-step explanation:

Given:

Equation of -x +2y =4

Point of (-2,1)

-x + 2y = 4

y = x/2 + 2 or y = 1/2x + 2

Which means the equation's slope is m = 1/2.

The slope of the perpendicular line is negative inverse which is m = -2.

Now we have an equation of y = -2x + a.

Use (-2, 1) to find a:

1 = (-2)(-2) + a

a = -3

y = - 2x - 3

a number subtracted from the product of
four and the number.

Answers

Answer:

x-(4+x)

Step-by-step explanation:

x is the number. and a number subtracted from the product of four and the number is basically saying x-(4+x)

What’s the slope intercept equation

Answers

Answer:

y=mx + b

Step-by-step explanation:

y= y intercept coordinate

m=slope=x coordinate

b = y intercept

You recently discovered that your job provides a 25% matching towards your retirement.
If you deposit $300 each month into a retirement account with an APR of 8.99%, what
would you type in Excel to find the balance after 30 years?

Answers

Answer:

What is typed in the attached Excel file is =FV(B4,B5,-B3,0,0).

Step-by-step explanation:

Note: See the attached excel file for the calculation of future value of an ordinary annuity.

Since we want to find the balance after 30 years, the function in the Excel is the FV function which is used to calculate the future value (FV) of an ordinary annuity as follows:

=FV(rate,nper,-pmt,0,0) …………………… (1)

rate = Monthly interest rate = APR / 12 = 8.99% / 12 = 0.0899 / 12 = 0.00749166666666667. Note: This is typed in cell B4 in attached excel file.

nper = periods = number of months = 30 years * 12 months = 360. Note: This is typed in cell B5 in attached excel file.

pmt = monthly payment = $300. Note: This is typed in cell B3 in the attached excel file. And also typed as a negative value in cell B7, i.e. as -B3.

pv = present value = 0. Note: This is the first 0 typed in cell B7 in the attached excel file.

type 0 = 0 this is typed to indicate that deposit is made at end of period as a regular or ordinary annuity. This is the second 0 typed in cell B7 in the attached excel file.

Based on the above, the FV function in equation (1) above is converted to the following which is typed in the attached Excel file to find the balance after 30 years:

=FV(B4,B5,-B3,0,0)

The above then gives a future value of $548,080.11 which is  the balance after 30 years.

Can y'all answer my question: 3d + 45 = 150

Answers

Answer:

d=35

Step-by-step explanation:

I NEED HELP WITH THIS MATH PROBLEM!!!

Answers

Answer:

72 degrees

Step-by-step explanation:

4x+6x=180

10x=180 combine like terms

10x/10=180/10

x=18

4(18) = 17

Complete the ordered pair for 4x - 5y = 23

Answers

Answer:

none of these

Step-by-step explanation:

please help me i rlly need help

Answers

Answer:

3

Step-by-step explanation:

Given a line with points; (2, 5) (3, 8).

1. Find the slope of the given line

The formula for finding the slope is:

[tex]\frac{y_{2}-y_{1} }{x_{2} - x_{1}}[/tex]

Substitute in the values;

[tex]x_{1} = 2\\y_{1} = 5\\x_{2} = 3\\y_{2} = 8[/tex]

[tex]\frac{8-5}{3-2}[/tex]

simplify;

[tex]\frac{3}{1}[/tex]

= 3

2. Find the slope of the parallel line;

Remember, when two lines are parallel, they run alongside each other, of infinitely long, but they never touch. Hence two parallel lines have the same slope. Therefore, the slope of a line that is parallel to the given one will also have the same slope as the given one, which is 3.

Please help I’m stuck on this question

Answers

Answer:

C. a => c

Step-by-step explanation:

       a                          b                           c                a => b          a => c (not C)

       0                          0                        0                    

       0                           0                        1                    

       0                          1                         0                    

        0                           1                         1                                          

        1                         0                          0                     F                  F

         1                        0                          1                      F                  

         1                        1                           0                                         F

          1                       1                          1

¬a                          b                           c                a => b          ¬a => c (not B)

       1                          0                        0                  F                  F

       1                           0                        1                  F  

       1                          1                         0                                       F

        1                           1                         1                                          

        0                         0                          0                                      

        0                        0                          1                                        

         0                        1                           0                                        

          0                       1                          1

a                          b                           c                a => b          c => a (not D)

       0                          0                        0                                        

       0                           0                        1                                            F

       0                          1                         0                    

        0                           1                         1                                           F

        1                         0                          0                     F                  

         1                        0                          1                      F                  

         1                        1                           0                                        

          1                       1                          1

¬a                          b                           ¬c                a => b          ¬a => ¬c

       1                          0                        1                                          

       1                           0                        0                                         F

       1                          1                         1                                      

        1                           1                         0                                        F

        0                         0                          1                 F                      

        0                        0                          0                 F                      

         0                        1                           1                                        

          0                       1                          0

answer: everything is false lol

each chicken has 2 legs. how many legs are there in a group of 9 chickens? show how you decided

Answers

Answer:

18 legs

Step-by-step explanation:

2 legs 9 chickens.

2*9 which is 18.

Hope this helps ;D

Evaluate the Expression: 8r - 4w - 9 when r = 7 and w = 4

Answers

Answer:

= 31

Step-by-step explanation:

So first plug in the numbers 8(7) - 4(4) - 16

then solve

56 - 16 - 9 = 31

Answer:

31

Step-by-step explanation:

8r - 4w - 9 when r = 7 and w = 4.

~Substitute

8(7) - 4(4) - 9

~Simplify

56 - 16 - 9

~Subtract

40 - 9

~Subtract

31

Best of Luck!

At a carnival, Tammy bought 9 packs of 17 tickets each. She has used 36 of the tickets so far. How many tickets does she have left?

㏒㏑⊂·_·⊃㏒㏑

Answers

117 tickets
You multiply the packs of tickets times the number of tickets per pack which will tell you how many tickets she has in total, 9*17=153 then subtract how many tickets she used from the total number of tickets. 153-36 then you will your answer

what is 19+1 pls help me

Answers

20 you jfjbwjcbdjhdjf

Please help!! Time is almost up and I’m having trouble with this question. Giving 20 points

Answers

It’s the third one for this question

Which equation represents the line that passes through the point (4, -5) and is perpendicular to the line x + 2y = 5?

Answers

Answer:

y = 2x - 13

Step-by-step explanation:

Equation of a line is y = mx + c, m is the gradient and c is the intercept

The line passes through points 4 and -5, x is 4 and y is -5

-5 = 4m + c

When two lines are perpendicular, the products of their gradients are equal to -1, m1 * m2 = -1

x + 2y = 5

2y = -x + 5

y = (-1/2 * x) + 5

therefore m = -1/2

m1 * m2 = -1

m * -1/2 = -1

-m = -2 , therefore m = 2

-5 = 4 * 2 + c

c = -5 - 8, which is -13

Therefore the equation for the line is

y = 2x - 13

pleaseeeeeeeeeeeeeeeeeeeeee help me i'm begging you so the questions is what is the multiplicative of 5 and 10-5k

Answers

Answer:

1/5 and -k/5+2

Step-by-step explanation:

inverse of 5= 1/5

swap the variables: y=10−5k becomes k=10−5y

Now, solve the equation k=10−5y

for y

y=−k/5+2

Isidro wants to purchase a used scooter that costs $89.75. The sales tax is found by multiplying the price of the scooter by 0.08. Find the ​total amount​ of money Isidro will pay. Round to the nearest cent.

Answers

Answer:

96.93

Step-by-step explanation:

89,75+

Use the graph to answer the question.
What is the average rate of change from x = 3 to x
= 11?
0 -8
1
001-
1
8
08

Answers

Answer:

Negative 1/8 is the answer

I need HELP, I'm just a dumb kid from Minnesota, I have no clue what to do...The line below has a slope of 2. Both points are on the same line. Find the values of a and b

Answers

Answer:

The values of [tex]a[/tex] and [tex]b[/tex] are 6 and 4, respectively.

Step-by-step explanation:

Geometrically speaking, any line is represented by equation of the form:

[tex]y = m\cdot x + b[/tex] (1)

Where:

[tex]x[/tex] - Independent variable, dimensionless.

[tex]y[/tex] - Dependent variable, dimensionless.

[tex]m[/tex] - Slope, dimensionless.

[tex]b[/tex] - y-Intercept, dimensionless.

In addition, the slope is defined in terms of distinct known points. That is:

[tex]m = \frac{y_{2}-y_{1}}{x_{2}-x_{1}}[/tex] (2)

If we know that [tex](x_{1},y_{1})=(4,b)[/tex], [tex](x_{2}, y_{2}) = (a, 8)[/tex] and [tex]m = 2[/tex], then the slope is:

[tex]\frac{8-b}{a-4} = 2[/tex]

[tex]8-b = 2\cdot (a-4)[/tex]

[tex]8-b = 2\cdot a -8[/tex]

[tex]b = 16-2\cdot a[/tex]

There is more than one option. If we assume that [tex]a = 6[/tex], then [tex]b[/tex] is:

[tex]b = 16-2\cdot (6)[/tex]

[tex]b = 4[/tex]

The values of [tex]a[/tex] and [tex]b[/tex] are 6 and 4, respectively.

1. What is the range? Write your answer like # (Don’t worry that it’s not the less than or equal sign)

Helppppppp

Answers

3y

Step-by-step explanation:

If pand q vary inversely and pis 28 when Q is 29. determine q when p is equal to 14.

Answers

9514 1404 393

Answer:

  q = 58

Step-by-step explanation:

If the variation is inverse, when p is multiplied by 1/2, q will be multiplied by the inverse (reciprocal) of 1/2, which is 2/1 = 2.

When p = (1/2)(28), q = (2)(29) = 59

  q = 58

Help please !!!!! Thanks

Answers

Answer:

7) y = -2

8) x = 4

Step-by-step explanation:

Any straight horizontal/vertical line you find will be x= or y=. The vertical lines are always x= because they only touch the x axis. It's the opposite for horizontal lines. For example, on number 7, the line touches -2 on the y axis. That's why it's "y=-2". Same goes for 8. the line only touches 4.

I hope this helped and wasn't confusing!

A school eams S70 from selling 50 tickets for the school play. Each ticket costs the same amount
How much does the school eam for 1 ticket?
Enter your answer in the box below.

Answers

Answer:

$1.40

Step-by-step explanation:

I used a unit rate to understand it.

$70/50

70÷ 50= 1.4

50÷50=1

1.4/1 = 1.4 OR $1.40, adding a zero doesn't change it amount, it just places a filler, so the final answer is, one dollar and forty cents.

Please help! BRAINLIEST to correct answer!!!

Answers

Answer:

−3x⋅(x+6)⋅(x−8)

Step-by-step explanation:

hp this helps

HELLLLP ASAP I NEED SOMEONE TO EXPLAIN PLEASE

Answers

Step-by-step explanation:

When it says you need to prove something

you need to place a statement about what you need to prove

and then a reason for why.

In this case

You need to prove that

Side AB is congruent (identical in form) to Side ED

Please help please help

Answers

Answer:

b

Step-by-step explanation:

cause if you divided 5 by 4 you'd get 1.25 then times that by 8 it'll give you 10 thus the answer is b

5 people working for 6 hours per day they complete they task task in 16 days. How many days would it take 8 people if they working 4 hours per day at the same rate?

Answers

Answer:

Can complete a work in 12 days working 8 hours a day Q can complete the same work in 8 days working 10 hours a day if both p and q work together working 8 hours a day in how many days?

Step-by-step explanation:

Answer:

6 hours x 5 person sx 16 days = 480 hours to complete the work.

480/ ( 8person * 4hours) = 15days

Thank you and please rate me as brainliest as it will help me to level up

2 6/7 ×3 1/4 idk what that answer is

Answers

Answer: The answer should be 9 2/7 I suppose.

4. To make te cups of hot chocolate, 4 tablespoons of cocoa mix
must be used. If a snack bar wants to make 36 cups of hot chocolate,
how much mix will they need?

Answers

Answer:

144

Step-by-step explanation:

You will multiply 4 tablespoons by the number of cups, that is how you get your answer.  ; )

Other Questions
Which ordered pair is a solution of the equation -4x + 7 = 2y - 3 which set of the numbers is equivalent to 75%? (0.75 3/5), (7.5 75/100), (3/4 0.075), (15/20 0.75) Identify the independent variable (domain). 5x+2y= 150 I WILL GIVE A LOT OF EXTRA POINTS. PLEASE ANSWER ALL OF THEM The manufacturers of can of salted mixed nuts state that the ratio of peanuts to other nuts is 6 to 5 . If 414 peanuts are in a can how many other nuts should also be in the can (8,9), X + 8y = 9Help me please What is 15% of 140? A.2,100 B.30 C.21 D.119 What was a vassal required to pay to their lord? crops money land tares Helppp ASAP. Emma wants to enlarge a square photo and print it to a square canvas. The sidelength of the canvas is 12 in. The scale from the canvas to the photo is 4 in. to 1 in.What is the side length of Emma's photo? Show your work. What other story element is most affected by the narrator's point of view?A) the story's titleB) the story's settingC) the story's theme Express the recurring decimal 0.56 (Just the 6 is recurring) in its simplest form. What should you ask yourself before you post a photo, video, or other information about another person online? 1. la seora Trevio tiene el doble de edad que suhijo hace 9 aos la suma de su edades era 30cual es su edad actual? ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut Philosophies born out of ancient China include____.A. BuddhismB. DaoismC. JainismD. Hinduism On a map, the distance between NY and Washington D.C. is 3.6 inches. The scale is 1 inch: 55 miles. What is the actual distance between the two cities? 31. The observed regularities in the properties ofthe elements are periodic functions of their(1) atomic numbers(2) mass numbers(3) oxidation states(4) nonvalence electrons Which describes an altocumulus cloud?a.high, feathery cloudc.low storm cloudb.puffy mid-level cloudd.high cloud made of ice crystalsPlease select the best answer from the choices providedABCD PLZZ ANSWER THE QUESTION What point of view is the poem "The Song of the Storm -- Spirits" written in?