Find the expected value of the winnings from a game that has the following payout probability distribution: Skip Payout ($) 1 2 5 8 10 Probability 0.35 0.2 0.1 0.2 0.15 Expected Value = [?] Round to the nearest hundredth.​

Answers

Answer 1

Answer:

$4.35

Step-by-step explanation:

The expected value of a random variable X, often denoted as E(X), indicates the probability-weighted average of all possible values/events. The general formula of expected value is

[tex]\mathrm{E(\textit X \mathrm)} = \displaystyle\sum_{\mathclap{i=1}}^{k} \ X \times P(X) \\ \\ \\ = X_{1} \times P(X_{1}) \ + \ X_{2} \times P(X_{2}) \ + \ X_{3} \times P(X_{3}) + \ \cdots \ + X_{k} \times P(X_{k})[/tex].

Therefore, the expected value of the winnings from a game is

[tex]\mathrm{E(\textit X \mathrm)} \ = \ 1 \times 0.35 \ + \ 2 \times 0.2 \ + \ 5 \times 0.1 + \ 8 \times 0.2 \ + 10 \times 0.15 \\ \\ = \ 4.35 \ \ (\mathrm{nearest \ hundredth})[/tex].


Related Questions

For the following problem, y varies directly as x If y = 34 when x = 4 , find y when x is 3.

Answers

Answer:

Step-by-step explanation: plug in 3 for X and then solve

Give me 5 stars

The median weight of 15 dogs in a pet store is 12 pounds. Which action could change the median?

Answers

Answer:

If there was another dog whose weight was greater than or less than 12.

Step-by-step explanation:

12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 4

When we add 4 to the data set we have:

184 ÷ 16 = 11.5

This changed the median.

12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 12 + 28

When we add 28 to the data set we have:

208 ÷ 16 = 13

This also changed the median.

By adding dog of  weight other than 12 pounds could change the median.

What is median?

The median is the middle number in a sorted, ascending or descending, list of numbers and can be more descriptive of that data set than the average. The median is sometimes used as opposed to the mean when there are outliers in the sequence that might skew the average of the values.

If we add the dog whose weight is more than 12 pounds, median will increase .

If we add the dog whose weight is less than 12 pounds, then median will decrease.

Hence, adding  dog of  weight other than 12 pounds could change the median.

Learn more about median here:

https://brainly.com/question/21396105?referrer=searchResults

#SPJ2

help me please please​

Answers

Answer:

alr yeah i get it now

Step-by-step explanation:

its A 11/14

Answer:

[tex]\frac{11}{14}[/tex]

Step-by-step explanation:

[tex]\frac{2}{7}[/tex] + [tex]\frac{7}{14}[/tex]

Before adding er require the fractions to have the same denominators.

Multiply the numerator/ denominator of the first fraction by 2

= [tex]\frac{2(2)}{7(2)}[/tex] + [tex]\frac{7}{14}[/tex]

=[tex]\frac{4}{14}[/tex] + [tex]\frac{7}{14}[/tex]  ( now add numerators leaving the common denominator )

= [tex]\frac{4+7}{14}[/tex]

= [tex]\frac{11}{14}[/tex]

what is linear independent vector​

Answers

A set of vectors is called linearly independent if no vector in the set can be expressed as a linear combination of the other vectors in the set. If any of the vectors can be expressed as a linear combination of the others, then the set is said to be linearly dependent.

I NEED HELP!!!!!
4. Three bags of Skittles and two bags of M&M's
weigh 3 pounds. Four bags of Skittles weigh 3
pounds. All bags of skittles weigh the same, and
all bags of M&M's weigh the same. What is the
ratio of the weight of a bag of Skittles to a bag of
M&M's?

Answers

Answer:

Step-by-step explanation:

How many Skittles is in a 4 pound bag?

Fun-size packages are perfect for parties, party favors, trick-or-treaters, gift baskets, lunch treats and on-the-go snacks. Approximately 20 individual packs per lb.

...

Skittles Fun-Size Packs, 4-Lb Box.

Order the following fractions from least to greatest: 11/5, 6/5, 1/5

Answers

Answer: 1/5, 6/5, 11/5.

Step-by-step explanation:

1/5 is the smallest, as it isnt even 1 whole! (5/5)

6/5 = 1 1/5.

11/5 = 2 1/5, so its the greatest

Evaluate the coefficient of x^5 and x^4 in the binomial expansion of (x/3-3)^7. Hence find the coefficient of x^5 in (x/3-3)^7(x-6)

Answers

Recall the binomial theorem:

[tex]\displaystyle (a + b)^n = \sum_{k=0}^n \binom nk a^{n-k} b^k[/tex]

where [tex]\binom nk = \frac{n!}{k!(n-k)!}[/tex] is the binomial coefficient.

Take a = x/3, b = -3, and n = 7. Then we get the x⁵ and x⁴ terms when 7 - k = 5 and 7 - k = 4, respectively; or when k = 2 and k = 3.

[tex]k=2 \implies \dbinom 72 \left(\dfrac x3\right)^{7-2} (-3)^2 = 21 \cdot \dfrac{x^5}{243} \cdot 9 = \dfrac79 x^5[/tex]

[tex]k=3 \implies \dbinom 73 \left(\dfrac x3\right)^{7-3} (-3)^3 = 35 \cdot \dfrac{x^4}{81} \cdot (-27) = -\dfrac{35}3 x^4[/tex]

Then when multiplying this expansion by x - 6, we get an x⁵ terms from the products

[tex]\dfrac79 x^5 \cdot (-6)[/tex]

and

[tex]-\dfrac{35}3 x^4 \cdot x[/tex]

so that the x⁵ term in the overall expansion of (x/3 - 3)⁷ (x -  6) has a coefficient of

[tex]\dfrac79\cdot(-6) + \left(-\dfrac{35}3\right) \cdot 1 = \boxed{-\dfrac{49}3}[/tex]

You visit two banks to determine their interest rates. Bank A offers you 6.2% annual
interest compounded monthly, and Bank B offers you 6.3% compounded quarterly.
Determine which bank is offering the best deal.

Answers

Answer:

  6.3% quarterly

Step-by-step explanation:

The monthly compounded rate is equivalent to a quarterly compounded rate of ...

  (1 +0.062/12)^3 -1 = 1.558%

The quarterly compounded rate is ...

  6.3%/4 = 1.575%

The 6.3% rate compounded quarterly is the better deal.

_____

Additional comment

An annual rate r compounded n times per year for m compounding periods is equivalent to a rate of

  (1 +r/n)^m -1 . . . per m/n of a year

Then an annual rate of r compounded 12 times per year for 3 months is equivalent to a quarterly (3/12 year = 1/4 year) of ...

  (1 +r/12)^3 -1

__

An annual rate of r compounded 4 times per year for 1 quarter is equivalent to ...

  (1 +r/4)^1 -1 = r/4

Which graph shows a linear equation?

Answers

Answer:

The bottom right is a linear equation.

Step-by-step explanation:

Answer:

right side down one

Step-by-step explanation:

as you know linear means supplementary having 180 °

Find the future value of 1000 at 7 % interest compounded annually for 10 years.​

Answers

Answer:

1967.15

Step-by-step explanation:

1000 x 1.07^10 = 1967.15

The future value of 1000 with annual compounding for 10 years is $1967.15.

The formula for calculating with annual compounding is:  

FV = P (1 + r)^n  

FV = Future value  P = the amount deposited R = interest rate   N = number of years  

1000 x (1.07)^10 = $1967.15

To learn more about future value, please check: https://brainly.com/question/18760477

Given that
P
=
x
+
y
.
Find
P
when:
x
=
3
and
y
=

11

Answers

Answer:

-8

Step-by-step explanation:

Pluck in the values:

P = 3 + (-11)

P = 3 - 11 = -8

2 + 2 = 3
prove me wrong

Answers

Answer:

2+2=4................

Answer:

you are wrong because 2+2=4

the area of a rectangle and square are same . if area of the square is 900 cm² and length of the rectangle is 45cm find the perimeter of the rectangle.​

Answers

Answer: 130cm

Let's think the width of the rectangle as, "x"

45*x= 900

x= 900/45

x= 20

45+45+20+20

= 130cm


find the area enclosed by the figure

Answers

Answer:

2677 mi^2

Step-by-step explanation:

Think the shape as an complete rectangle :

The area of the rectangle is calcluated by multiplying height*width

(24+12+19)*55 = 3025 mi^2 now subtract the area of the missing part using same area calculation method:

12*29 = 348 mi^2 the area of the figure:

3025 - 348 = 2677 mi^2

Two parallel lines are cut by a transversal, as shown below. Solve for b. Then explain your reasoning.

Answers

Answer:

b=14

Step-by-step explanation:

the two labeled angles are vertical angles. according to the vertical angles theorem, they must be equivalent. therefore, we can set them equal to each other and solve.

5b=b+56

4b=56

b=14

In this exercise we want to calculate the value of b knowing that these are parallel lines, like this:

[tex]b=14[/tex]

What is a parallel line?

They are two distinct lines that have the same angular coefficient, they never intersect and there is no point in common between them.

With this information we can solve this exercise as:

[tex]5b=b+56\\4b=56\\b=14[/tex]

See more about parallel lines at brainly.com/question/16701300

The solution to the following inequality:
-3(6-2g)>4g

Answers

Answer:

Solution: g > 9

Interval Notation: (9 , ∞)

Step-by-step explanation:

-3 * (6-2g) > 4g

-18 + 6g > 4g

6g - 4g > 18

2g > 18

g > 9

Multiply and write in standard form:
(2x)(x^2 - 6x + 3)
Show all work for full credit.

Answers

2x(x2-6x+3)

4x^3-12x^2+6x

if the poins A(-6,-5),B(-3,-2) and C(3,k) is on the same straight line, find the value of k.

Answers

Answer:

4

Step-by-step explanation:

y = x + 1

yeah-ya.... right?

Answer:

4 is the answer i believe

Step-by-step explanation:

C skips 2 dots, Hope this helps:)

Which of the following integers is less than -23?
a) o
b) -13
c) 13
d) -25

Answers

Answer:

i think d) -25 is answer

Step-by-step explanation:

good luck

Answer:

d) -25

Step-by-step explanation:

Because -25 is less than -23 . as it is negative integers

Is it (sss) (side side side ) Hypotenuse-Leg (HL), ssa?(sas) aaa,asa,aas?

Answers

Here, both the triangles have equal sides.So, the two triangles are related by SSS.If all the sides of a triangle are equal to all the sides of another triangle, so the triangles are congruent to each other.

Answer:

SSS, congruent.

Hope you could get an idea from here.

Doubt clarification - use comment section.

Select the correct answer.
What is the factored form of this expression?
433 – 8x2 – 9x + 18
--
-
A. (2x − 3)(2x - 3)(x - 2)
B. (2x + 3) (2x − 3)(x + 2)
C. (2x + 3)(2x + 3)(x - 2)
D. (2x + 3)(2x − 3)(x - 2)

Answers

Answer:

Option D

Step-by-step explanation:

Use Factoring Methods

[tex]4x^3-8x^2-9x+18\\[/tex]

put bracket around each 2 terms as such [tex](4x^3-8x^2)+(-9x+18)[/tex]

And then factor each respective bracket. We'll start with the first one

[tex](4x^3-8x^2) = 4x^2(x-2)[/tex]

Then do the other, and try to get similar brackets as the first

[tex](-9x+18)=-9(x-2)[/tex]

Since they are both simiar, the equation is now: [tex](4x^2-9)(x-2)[/tex]

Now factor the first bracket again for final result

[tex]4x^2-9=(2x-3)(2x+3)[/tex]

Ans when you put it all together, you get: [tex](2x-3)(2x+3)(x-2)[/tex]

Correct answer is option D

What is the volume of the irregular figure?

Answers

Answer:

the answer u r looking for is 144

Step-by-step explanation:

if u know who this is i will follow u

hint: its from avatar tla

only the first person that answers!!!

Help me with writing a check please

Answers

Answer: pay to the order of: Price Chopper.... $145.19.... next line: One hundred forty-five and 19/100.... bottom left line: whatever the money is for.... next line: signature.        5. fifty-four and 68/100 dollars  6. One hundred seventeen and 92/100 dollars      7. twenty dollars

Step-by-step explanation:

What is -3/4+2 3/4 O 3 1/2 O 3 3/4 O 2 1/2 O 2​

Answers

Answer:

D. 2

Step-by-step explanation:

Common denominator is already presented which is 4.

-3/4 and 3/4 cancel each other out.

you can also convert to decimal form -3/4 + 2 3/4 is the same as:

-0.75 + 2.75 = 2.

The circle graph below represents the opinions of 100 students about their favorite sports. Each student chose exactly one of these four options: Basketball, Hockey, Football, and Other. The following statements are true about the graph:

The number of students who chose Basketball is three times the number of students who chose Other.

Ten more students chose Football than chose Hockey.

The percent of students who chose Basketball plus the percent of students who chose Football equal 65.

What percent of the students chose Basketball?

Answers

Answer:

Yo…what’s the graph?

Step-by-step explanation:

If a shirt for RS 18 is marked up to RS 20 then the percentage increase is equal to

Answers

Answer:

11.1%

Step-by-step explanation:

Increase = 20 - 18

= 2

% increase= increase/initial price × 100

= 2/18 × 100

11.1%

HELPPPP PLEASEEEEE ​

Answers

I’m not rly sure what it means by flipping the card …. I’m assuming there’s more to this question but if it’s what I think it is the only way this equation will be true is by switching the + Symbol to - (subtraction) which would be 1-2= 3-4 since it would 1=1 making the equation true

How many cubes with side lengths of 1/3 does it take to fill the prism

Answers

Step-by-step explanation:

along the side with 1 cm we can fit 3 cubes, as 3×1/3 = 1.

along the side with 2 2/3 cm we can fit 8 cubes :

2 2/3 = 6/3 + 2/3 = 8/3.

and 8/3 / 1/3 = 8/3 × 3/1 = 3×8 / 3×1 = 8

and the height is 2/3 cm, so we can put 2 layers of cubes on top of each other.

so, we have

3 × 8 × 2 = 48

48 cubes are needed to fill the prism.

Please answer the file question.

Answers

WT is 63 units long. Work on paper.

Answer:

WT = 63

Step-by-step explanation:

Given Δ SDE is similar to Δ SWT then the ratio of corresponding sides are in proportion, that is

[tex]\frac{WT}{DE}[/tex] = [tex]\frac{ST}{SE}[/tex] , substitute values

[tex]\frac{5x+3}{56}[/tex] = [tex]\frac{4x-3}{40}[/tex] ( cross- multiply )

56(4x - 3) = 40(5x + 3) ← distribute parenthesis on both sides

224x - 168 = 200x + 120 ( subtract 200x from both sides )

24x - 168 = 120 ( add 168 to both sides )

24x = 288 ( divide both sides by 24 )

x = 12

Then

WT = 5x + 3 = 5(12) + 3 = 60 + 3 = 63

How do I add mixed numbers?

Answers

Step 1 - find the lowest common multiple between the denominators step 2 - multiply the numerator and denominator of each fraction step 3 - Add or subtract the numerators and keep the denominator the same.
Other Questions
,48003. Alexander is taking 15 credit-hours this semester at college. Therelationship between tuition and credit hours is shown by the graph below.What is the constant of proportionality?A. 15B. 400C. 800D. 60004400400036003200280024002000Tuition1600120080040023S4Credit Hours7&9 Write (5/3) as a quotient of powers. PLSSSS HELPPPP ASAPPPP. REWARDING BRAINLIEST. PLS SHOW WORK3. What are the exact measures of the other two sides of the triangle? Use special right triangles ratios and show your work. Which feudal leader was responsible for laying the foundation for the European civilization following the fall of the Roman Empire? A:Charalemange B: Wiliam the conqueror Tropical dried fruit costs $1.50 per pound and regular dried fruit costs $0.90 per pound. You want to create a mixed bag of tropical dried fruit and regular dried fruit that is worth $1.30 per pound. How many pounds of tropical dried fruit do you need if you have already purchased 50 pounds of regular dried fruit? EASY 9TH GRADE MATHWrite an equation in point-slope form that passes through the point (1,-10) andis perpendicular to y = -1/3 x + 5.Do NOT type spaces between numbers and symbols.TilALE11SE What does this chart reveal about education in South Africa? How do you think this will affect the economy? If (6^2]^p = 6^10, what is the value of p? A.) 2 B.) 3C.) 4D.) 5 has anyone done this and if u have please help me !! :(( How many moles does 205 g of helium,He, contain ? which best explains the impact of european colonization on the inca and aztec civilizations? When is it best to solve a system of equations using substitution? As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts):