Explain why a person can survive if they exclusively eating a protein diet. What are the hazards if any?

Answers

Answer 1

Answer:

Risks of high protein diet

Explanation:

Some high-protein diets include foods such as red meat and full-fat dairy products, which may increase your risk of heart disease. A high-protein diet may worsen kidney function in people with kidney disease because your body may have trouble eliminating all the waste products of protein metabolism.


Related Questions

easy question - giving brainly if correct !!​

Answers

Answer:

i think its  C

Explanation:

i would go with c


Concentration of water in a solution outside the cell is 30% The concentration of
water inside the cell is 70%. In what direction will the solvent move if diffusion
occurs? Is energy required?

Answers

Answer:

water will move out of the cell,energy is required

Explanation:

water moves through osmosis which is the movement of water molecules from a region of higher concentration to a region of lower concentration.

The following are the results of a genotype being "foiled" for a dihybrid cross: BS, Bs, bS, bs.

Determine the parents' genotype
A. BbSS
B. BBss
C. BsSs
D. BBSS

Answers

Answer:

C.

Explanation:

which muscle cells have desmosomes and gap junctions

Answers

Answer:

Cardiac muscle cells are rectangular-shaped cells connected by regions called intercalated discs. Intercalated discs contain gap junctions and desmosomes.

Explanation:

The muscle cells that have desmosomes and gap junctions are cardiac and smooth muscle cells. The correct option is C.

What is a cardiac cell?

Cardiac cells are the chain of myofibrils and look like a chain of rods. It is of red color. Cardiac muscle cell has three types of gap junction. The two types are sheet desmosomes and spot desmosomes.

The options are attached below.

Thus, the correct option is C. cardiac and smooth muscle cells.

Learn more about cardiac cell

https://brainly.com/question/14005473

#SPJ2

5. What natural phenomenon converts nitrogen into the form which organisms can use?

Answers

Answer:

the nitrogen cycle

Explanation:

How does a substance cross the cell membrane in diffusion?
a- flowing down the concentration gradient
b- binding to a carrier protein
c- going through a pump
d- going through a channel protein
(ck-12)

Answers

Answer:

A

Explanation:

how does the plasma membrane contribute to the structure and function of the cell?

Answers

Answer:

The plasma membrane, also called the cell membrane, is the membrane found in all cells that separates the interior of the cell from the outside environment. ... The plasma membrane consists of a lipid bilayer that is semipermeable. The plasma membrane regulates the transport of materials entering and exiting the cell.

A cell is protected by its cell membrane, also known as the plasma membrane. Additionally, it moves hazardous materials out of the cell and carries nutrients into the cell.

What is a cell membrane?

All cells' interiors are protected from the outside world by a biological membrane called the cell membrane. A cell is protected by its cell membrane, also known as the plasma membrane. Additionally, it maintains a constant environment inside the cell, and that membrane serves a variety of purposes. One is to move substances out of the cell that are toxic as well as nutrients into the cell.

Glycerophospholipids, molecules made of glycerol, a phosphate group, and two fatty acid chains, are what make up cellular membranes, including plasma membranes and internal membranes.

Learn more about cell membrane, here:

https://brainly.com/question/13524386

#SPJ5

quién me ayudaría a hacer este crusigrama
gracias ​

Answers

Answer:

Respuesta: hola ami me parece que ya lo hiciste pero te dejo ejemplos:

Explicación: 1.Venezuela

2. Sanclemente

3. Marroquin    

me das corona plis chau

Explanation:

what type of inheritance do two alleles have if their traits blend together?

Answers

Answer:

Explanation:

Codominance is when both dominant traits are expressed, therefore if white was considered dominant and red was also a dominant trait, the petals would have spots of white and red, with no pink. Polygenic inheritance is described by one characteristic influenced by multiple genes, which is not the case in this problem.

what is occurring during the s phase of the cell cycle?

Answers

The S phase of a cell cycle occurs during interphase, before mitosis or meiosis, and is responsible for the synthesis or replication of DNA. In this way, the genetic material of a cell is doubled before it enters mitosis or meiosis, allowing there to be enough DNA to be split into daughter cells.

Pls give brainliest ❤️

A bar graph and a pie graph are the same thing.

A. True
or
B. False​

Answers

Falseee !!! I'm suree
B. False
Pie charts show how much each category represents as a proportion of the whole and Bar graphs use a series of rectangular bars to show absolute values or proportions for each of the categories

#5 and 6 pleasee I will give you 100 points

Answers

6)it is bigger then we ever thought and that we wont beable to explore it all..

CORRECT ME IF I AM WRONG

6) it is bigger then we ever thought and that we wont beable to explore it all

sorry if this didnt help

which term describes the ability of neurons to process information, store and recall it, and make decisions?

Answers

Answer:

Neural Integration

Explanation:

:)

what is the role of microfilaments in cell division

Answers

Answer:

. Microfilaments help the cell lay down new membrane and divide into two daughter cells.

Explanation:

How are male and female reproductive organs similar?

Answers

Answer: They are the same in that most of the reproductive organs of both sexes develop from similar embryonic tissue, meaning they are homologous. Both systems have gonads (male have testes and female have ovaries) that produce gametes (testes produce sperm and ovaries produce egg or ovum) and sex organs.

where are the proteins of the electron transport chain located in a eukaryotic cell?

Answers

Answer:

In eukaryotes, the electron transport chain is located in the inner mitochondrial membrane. In prokaryotes, it is located within the plasma membrane

nucleic acids are assembled in the _____ direction.

Answers

5’ to 3’ hope this helps:)

Nucleic acids are assembled in the 5' to 3' direction during DNA replication. DNA replication is the process of duplication of DNA molecule.

What are Nucleic acids?

Nucleic acids are the biomolecules occurring in the chemical compounds which serve as the primary information-carrying molecules in the cells. Nucleic acids play an important role in directing the process of protein synthesis. The two main classes of nucleic acids include deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

Nucleic acids can only be synthesized in vivo in the 5′-to-3′ direction and these can be assembled in the same direction in cell, as the polymerases which assemble various types of new strands generally rely on the energy which is produced through breaking the nucleoside triphosphate bonds to attach these new nucleoside monophosphates to the 3′-hydroxyl (−OH) group, through a phosphodiester bond.

Learn more about Nucleic acids here:

https://brainly.com/question/11309892

#SPJ6

Tại sao con người chúng ta lại sốt nhiều lần như vậy?

Answers

Answer:

Fever is an elevated temperature of the human body that is substantially beyond the normal range. Normal body temperature fluctuates daily from about one degree below 98.6 degrees Fahrenheit to one degree above that number. Lower body temperatures usually occur before dawn; higher temperatures in the afternoon.

Body temperature also varies slightly depending on where on the human body it is measured. Rectal (internal) temperature tends normally to be higher than skin (surface) temperature. Oral and armpit temperatures can approximate actual body temperature and are more convenient to measure.

how can an understanding of osmosis be important in developing methods for the same storage of food?

Answers

Osmosis is also used for preserving fruits and meats, though the process is quite different for the two. In the case of fruit, osmosis is used to dehydrate it, whereas in the preservation of meat, osmosis draws salt into it, thus preventing the intrusion of bacteria.

74 POINTS!!!!
How could addressing market failure help make an economy more environmentally sustainable?

Answers

Answer:

If companies are held accountable upfront for the consequences their actions will have on the environment, their actions may be more environmentally friendly from the beginning.

Explain your observations. What did you observe as you added phenolphthalein to the ammonia solution? What did you observe when vinegar was added?

Answers

Answer:

Liquid ammonia is liquefied ammonia and is basic in nature. It dissolves in water to give ammonium hydroxide which ionizes to give hydroxyl ions. Therefore it turns red litmus blue and phenolphthalein solution pink.

When two substances create a solution, what happens to its mass?
A.The mass is increased.
B.The mass is decreased.
C.The mass stays the same.
D.The mass disappears.

Answers

The mass is increased becuase you are adding two substances together, you are adding their individual masses together

74 POINTS!!!!!!!!
Do you think we should attempt to
quantify and assign market values
to ecosystem services and other
entities that have only non-market
values? Why or why not?

Answers

Answer:

yes

Explanation:

yes because I like the same thing cuz you just like doing like what you have to do and I did it already and I got it a

easy - one giving brainly if correct AND DETAILED!
please give me at least 2.​

Answers

Well you see theres this guy named MrBeast thats taking little kids money and is having one of his slaves eat a water bottle for every dollar

Answer:

Well recently Team Seas has come out for every dollar donated I think it's 1 pound of trash so by donating would be one.

The second would be volunteering to help clean up for example a beach.

For more lasting impact would be to have a machine that collects the trash at where the rivers and streams meet the ocean this will lead to less trash in the ocean. There is a great example of this machine by Mark Rober gives a detailed explanation.

The cell membrane is said to be semipermeable because

Answers

Answer:

The membrane is selectively permeable because substances do not cross it indiscriminately.

Explanation:

which statement is true about the nitrogen bases in dna and rna?

Answers

Explanation:

in DNA nitrogen bases are adenine, thymine, guanine and cytosine and in RNA nitrogen bases are same but instead of the thymine there's uracil

in DNA there are linked together adenine and thymine ; Guanine and cytosine. And in RNA adenine and uracil; Guanine and cytosine.

skeletal muscle exhibits alternating light and dark bands called

Answers

Skeletal muscle exhibits alternating light and dark bands called a sarcomere

Skeletal muscle is having sarcomere having myofibrils which appear dark and light in the microscope.

What is skeletal muscle?

Only thin filaments containing actin are present in isotropic bands, anisotropic bands are the darker bands (A bands).

Repeating sarcomere sections, which are visible under the microscope as alternating dark and light bands, make up myofibrils.

When a muscle contracts or relaxes, long, fibrous protein filaments called sarcomeres glide past one another. Because of this, skeletal muscle is also known as striated muscle.

Therefore in appearance due to myofibrils composed of the sarcomere look light and dark bands in the skeletal muscle under a microscope.

Learn more about skeletal, here:

https://brainly.com/question/29215804

#SPJ2

the age of a woolly mammoth can be determined by examining what?

Answers

Answer:

examining the tusks, bones, teeth, (carbon levels in tissues depends)

Explanation:

Carbon-14 can be used to date the remains of dead organisms because all living things use carbon to build tissue.

The biological age of mammoths (also known as the "age at death") is usually estimated by comparison to correlations between the biological age and the wear stages of grinding teeth in extant elephants. As tusks grow, they continually incorporate ingested strontium (Sr), and the incremental record of strontium isotope ratios (87Sr/86Sr) in tusks and teeth can be used to investigate proboscidean movements

scrutinizing the bones, teeth, and tusks (carbon levels in tissues depends)

What are Mammoth?

All living things need carbon to create tissue, making carbon-14 a useful tool for dating the remains of deceased species.

Mammoths' biological age, also known as the "age at death," is typically calculated by comparing it to correlations between that age and the phases of tooth wear in living elephants.

The incremental record of strontium isotope ratios (87Sr/86Sr) in tusks and teeth can be used to study proboscidean movements as tusks continuously integrate ingested strontium (Sr).

Therefore, scrutinizing the bones, teeth, and tusks (carbon levels in tissues depends).

To learn more about Mammoth, refer to the link:

https://brainly.com/question/24163999

#SPJ2

what do you call an organism that has been genetically engineered to contain a gene from a different species?

Answers

Answer:

A transgenic, or genetically modified, organism is one that has been altered through recombinant DNA technology, which involves either the combining of DNA from different genomes or the insertion of foreign DNA into a genome.

Explanation:

Answer:

This would be called a transgenic or genetically modified organism.

Explanation:

A transgenic or genetically modified organism is one that has been altered through something called recombinant DNA technology. Which involves either the combining of DNA from different genomes or in another case the insertion of foreign DNA into a genome.

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?

Other Questions
Seven large hamburgers are shared equally among twelve people at a dinner. Which of the following shows the amount of a hamburger that each person eats? [tex]3\sqrt[n]{x} 125[/tex] Write 3 ways you could ask for help for yourselfor a friend? Someone pls help me I will make you brain how objects are charged [i.e. friction, etc] How is a cruise ship like a cell? Name the organelles that have a similar function to the parts of a cruise ship. Ill give brainliest, thanks and 5 stars to the answer that stated all the organelles that are similar in function to the parts of a cruise ship. Triangle ABC is a right triangle what process provides the energy that allows crustal plates to move across the surface of the earth? Ionic bonds form between which two types of elements? Can you plssssssssssss help meCan you do plsssssssss help meeee A number cube is rolled.What is P(2)Enter the answer as a fraction, decimal, and percent in the boxes. Round each decimal and percent to the nearest hundredth.At what is the inverse function of h(x)=-3/5x+1/2? All the visitors to the power plant mustwear clothing provided when entering the laboratory. (A) protect(B) protection (C) protectiveD) protecting Kendra is a quality assurance inspector for a toothpaste manufacturer what would be one task that Kendra might perform as part of her jobI give 20 points Please help! Will mark brainliest if its the correct answer! Its also not C or D, I tried those out and it wasnt that (I have one more attempt left) While a child watches, you hide a Cheerio under one of two cups in front of her. You hide the Cheerio under the red cup, and show the child that there is nothing under the blue cup. If this child has not yet achieved object permanence, she will: __________ a. not look for the Cheerio. b. look for the Cheerio under the blue cup. c. look for the Cheerio under the red cup. d. look for the Cheerio in your hand. Please help with this, but the number you are answering before you answer. If someone has already put the answer, you can still do it. thank you \text{walmart sells 6oz bottle of laundry detergent for 4.80. what is the price per ounceSHOW ME HOW YOU SOLVED IT! Imagine you are in a magical land then you are got lost What are Advancing Colors