Answer:
Dicer
RNA-dependent RNA polymerase amplifies siRNAs by binding to them and making more dsRNA, which is recognized and cleaved by Dicer into secondary siRNAs. The result is the silencing of genes by amplifying the RNAi effect. In certain cases RNAi also silences genes by the formation of heterochromatin.
compare a frogs internal organs to a humans internal organs
Answer:
Answer is below
Explanation:
Frogs and humans share the same basic organs. Both have lungs, kidneys, a stomach, a heart, a brain, a liver, a spleen, a small intestine and a large intestine, a pancreas, a gall bladder, a urinary bladder and a ureter. ... On the whole, their organ structure is similar, but frogs have considerably less complex anatomies
Cows, buffaloes and wildebeest are closely related enough that the same disease can harm all of them true or false
Why animals reproduce? A. To become many B. To become food C. To enjoy D. To grow
Question:
Why animals reproduce?
Answer;
(A) To become manywhy?
because if no animals in the world you will not enjoy of your childhood
that is my answer I hope it helps to you
Is fermentation as efficient as aerobic cellular respiration? Multiple choice question, yes or no?
Answer:
NOEXPLANATION :
Aerobic cell respiration is roughly 18 times more efficient than anaerobic cell respiration. Your cells require a lot of energy and are dependent on the high efficiency of aerobic respiration. They quickly die if deprived of oxygen.
Explain the the verse below in your own words.
Hebrews 11:7
Answer:
Faith, according to the Bible, is not blind. More than half of the verses in the book of Hebrews are dedicated to explaining reasons and evidence to accept the new covenant in Jesus Christ. Nor is faith gullible, or senseless. Instead, godly faith is exemplified by trust. That trust is based on what we know of God, relying on Him for the things we do not know. In particular, godly faith looks forward, from an eternal perspective, and produces obedience, even in the face of hardship. God takes what we cannot see, or cannot understand, and uses it to make good on His word. Since faith relies on what we've seen of God, and trusts Him for the future, it becomes the "assurance of things hoped for, the conviction of things not seen" (Hebrews 11:1–3).
Explanation:
I LOVE JESUS
CAN I HAVE A BRANLIEST PLZ
Faith, according to the Bible, is not blind. More than half of the verses in the book of Hebrews are dedicated to explaining reasons and evidence to accept the new covenant in Jesus Christ. Nor is faith gullible, or senseless. Instead, godly faith is exemplified by trust. That trust is based on what we know of God, relying on Him for the things we do not know. In particular, godly faith looks forward, from an eternal perspective, and produces obedience, even in the face of hardship. God takes what we cannot see, or cannot understand, and uses it to make good on His word. Since faith relies on what we've seen of God, and trusts Him for the future, it becomes the "assurance of things hoped for, the conviction of things not seen" (Hebrews 11:1–3).
more complex
mito-
Chondria
___
Contains
DNA
mitochondria
produce
ATP
Which is used by
___ To make___
Which pass the to interior of the
golgi
Then are modified by the
golgi
Then are distributed to
Parts of the cell
Answer:
Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.
Explanation:
Answer:
Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.
Explanation:
Examine the food web below. Suppose the local government sprayed a pesticide to kill mosquitoes. The sparrows ate the poisoned mosquitoes and died as well. What would most likely happen to the organisms in this food chain after the sparrows began to disappear?
A.
There would be an overpopulation of caterpillars, which would threaten the oak trees.
B.
The sparrows’ disappearance would not affect the other organisms in the ecosystem.
C.
Most of the organisms in the ecosystem would starve and die.
D.
The eagle would loose its primary food source and be forced to start feeding on mountain lions.
Answer:
A. There would be an overpopulation of caterpillars, which would threaten the oak trees
Explanation:
Because sparrows eat caterpillars as a primary food source, when the population of sparrows decrease, the population of caterpillars will increase. Because of this, more caterpillars will be feeding off of the oak trees, therefore threatening the oak trees. I hope this helps!
1. Why is cell an open dynamic system?
The exchange of matter or substances between the cell and its environment is dynamic as it varies in direction and rate as per the requirements of the cell. Thus,a cell attains a stead -state wherein the internal conditions of the cell remain constant. Hence, cell is considered to be a open dynamic system
Which indicates a heterozygous genotype for smooth pods?
A. ss
B. SS
C. Ss
Answer:
C. Ss
Explanation:
One dominant allele (S) and one recessive allele (s) indicates a heterozygous trait.
In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style
Answer:
Anther
Explanation:
Stamen is a male reproductive part in which anther produce male reproductive cells.
Answer:
The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.
Explanation:
A dowry is:
A.
Money or property given by a man to or for his bride
B.
A gift given by the bride to her mother-in-law
C.
Money or property given by a man to his parents
D.
Money or property given by the bride to her parents
Answer:
B
Explanation:
As dowry system is the social problem in which the bride/bride's family has to give money or property to the groom's family.
The bride/bride's family has to give money or property to the groom/groom's family on their marriage.
The gene for fur color in mice has two alleles, the allele for gray fur
(G) is dominant to the allele for black fur (g). What would be the
phenotype of a mouse with genotype gg?
Answer:
the phenotype of a mouse with genotype is g
Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well
Answer:
the first one
Explanation:
.
Which forest biome has year-round
precipitation in many forms, is very
diverse with deciduous trees,
flowering trees, and shrubs, and
abundant growth in spring?
A. Temperate forest
B. Coniferous forest
C. Tropical rainforest
D. Tropical dry forest
Answer:
Due to their global position, temperate forests generally receive about 75-150 cm of precipitation every year.
Explanation:
(That's a lot, second only to the Tropics).
Question 15 of 20
What is true about ice and liquid water?
O A. Ice has a lower density than liquid water because it has more
space between molecules.
O B. Ice has a higher density than liquid water because it has more
space between molecules.
O C. Ice has a higher density than liquid water because it has less
space between molecules.
O D. Ice has a lower density than liquid water because it has less sace
between molecules.
Answer: B
Explanation:
Answer:
I think A! Sorry if wrong!
An insulator the loss of heat energy.
slows down or speeds up
I WILL MARK YOU BRAINLYSS PLUS 40 POINTSSS
Answer: Slows down
Explanation: Insulation slows does the transfer of heat energy. think of it like this. a puffer jacket (more insulation) keeps you warmer longer than a t-shirt (less insulation).
:)
In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction
Answer:
The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.
Explanation:
The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
Answer:
look at explanation
Explanation:
basically in order to go from mrna to trna just replace
a becomes u
g becomes c
u becomes a
c becomes g
8. If brown (B) noses are completely dominant to blue (b) noses, write
genotypes combinations and phenotypes you could have in any given individual.
Which of the following characteristics are necessary for a fossil to be a good index fossil? (Choose all that apply)
had a broad geographic distribution
easy to identify at the species level
an invertebrate
short-lived
Answer:
A good index fossil is one with four characteristics: it is distinctive, widespread, abundant, and limited in geologic time. Because most fossil-bearing rocks formed in the ocean, the major index fossils are marine organisms.
Explanation:
Fossil to be a good index fossil are:-
Had a broad geographic distributionEasy to identify at the species levelAn invertebrateShort-livedWhat is a fossil?Fossils are the preserved remains, or traces of remains, of ancient organisms. Fossils are not the remains of the organism.They are rocks. A fossil can preserve an entire organism or just part of one. Bones, shells, feathers, and leaves can all become fossils.Hence, All the given option are correct.
To know more about fossils here
https://brainly.com/question/6867325
#SPJ2
muscle cell labelled diagram
Explanation:
Here is a diagram, let me know if this is what you needed.
Question 7(Multiple Choice Worth 2 points) (06.02 MC) Read the two sentences. The boy scored the winning goal is on my team. name is Greg. Select the words that complete the sentences. o . that. His that. Their O who. His who. Their
Answer:
The boy that scored the winning goal is on my team. His name is Greg.
Explanation:
Which of these is not an effect of antibodies?
A. Activating complement proteins
B. Neutralizing toxins
C. Tagging pathogens for phagocytosis D.Perforating membranes of pathogens
Answer:
C
Explanation:
Tagging pathogens for phagocytosis D.Perforating membranes of pathogens
Which of the following are unique to animals? Flagellated gametes, nervous system signal conduction in muscular movement, heterotrophic, the structural carbohydrate chitin
Answer:
Nervous system signal conduction in muscular movement
Explanation:
Hope i helped :)
which is not a topic of biology?
a. the distribution of sand on an ocean floor
b. the chemicals at work in the stomach
c. the speed at which a hummingbird flies
The Maine Department of Transportation (DOT) has a fleet of roughly 400 plow trucks that are used to control snow and ice on approximately 8300 lane miles of Maine’s state roads. They usually plan on an average of about 30 treatable events in a winter. This includes the use of rock salt, salt brine and winter sand, a mix of sand and salt. Salt brine is used on roads and bridges prior to a storm to delay ice and snow from sticking to the roadway and is also used in plowing to fight the buildup of ice and snow throughout the storm. Rock salt helps keep roads safe when winter storms hit, reducing winter road accidents, but it can also have negative effects on plant life and aquatic ecosystems. What are the environmental effects of salting that must be mitigated? Select ALL that apply.A) Salt kills roadside plants. B) Salt builds up in roadside soil , changing its pH, preventing the growth of plants. C) Salt corrodes metals like automobile brake linings, frames, and bumpers, and can cause cosmetic corrosion. D) Elk, moose and sheep eat road salt causing "salt toxicosis" where they lose their fear of vehicles and humans, causing many fatal encounters. E) Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground
Answer:
it is 736
Explanation:
me big brain
Salt builds up in roadside soil , changing its pH, preventing the growth of plant and Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground are the environmental effects of salting that must be mitigated. That is option B and E.
The effects of road salting on the environmentRoad salting is a technique that is used to melt snow and ice during winter season. This keeps the streets and side sidewalks clear and prevents slick driving conditions.
The types of salt used for road salting include:
rock salt, salt brine,winter sand, a mix of sand and salt.The impact of road salting on the environment include the following:
Decrease in reproduction and growth of plants: This is because increase salinity are toxic to plants and as the concentration of these ions increases, the plant is poisoned and dies.Negative effect on aquatic ecosystems: This affects mostly the freshwater ecosystems as high levels of salt are very toxic to the aquatic organisms.Learn more about aquatic ecosystems here:
https://brainly.com/question/1023703
Describe the structure and function of areolar connective tissue.
Answer:
Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.
Giving Away 50 points + brainy to first
Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a/an ____
The group of components of the Earth work together to make an environment we live in.
What are the different components of the Earth?The interactions between Earth's five systems—the geosphere, biosphere, cryosphere, hydrosphere, and atmosphere—create the environment we are accustomed to.
The Earth's interior and surface, which are both formed of rocks, make up the first system, the geosphere. The second system is made up of the little area of the planet that may sustain life; this area is known as the biosphere. The third system contains the hydrosphere, or regions of Earth that are completely covered with water. The fourth system is the atmosphere, a gaseous envelope that maintains the planet's temperature while also supplying carbon dioxide for photosynthesis and oxygen for breathing. The cryosphere, which is composed of enormous amounts of ice in the poles and elsewhere, is the fifth system. The maintenance of the Earth as we know it depends on the interaction of all five of these vast and intricate systems.
Learn more about Earth's component, here:
https://brainly.com/question/11250595
#SPJ5
Remove the roller bearing fastened to the shaft:
A. Dumplings in bearings.
B. Close the ring in the bearing or the ring in the bearing.
C. Close the ring in the bearing.
D. Roll out the outer ring of the bearing.
Answer:
B-Close the ring in the bearing or the ring in the bearing.
Explanation:
hope it's help
What kind of alleles get over-shadowed or blocked by more dominant alleles?
Answer:
I believe these are called the recessive traits or alleles
Explanation:
Recessive traits (represented in a pinnet square usually by lower case letters like rr, bb, pp, mm, ll and so on and so forth)
These traits can be blocked by the dominant ones ( BB, Bb, PP and so on and so fourth)
look at the punnet square to get a better visual :3