Determine the value of the unknown
0 - e = 5

Answers

Answer 1
The answer would be -5 because then you can do the opposite, 0+5 which would equal 5

Related Questions

Please help me solve this math problem

Answers

Answer:

I think it is undefined.

After a party there is 3/4 of a pizza left. You split it evenly between you and 3 friends. What fraction of a pizza does everyone get?

Answers

Answer:

3/16

Step-by-step explanation:

3/4÷4=3/16

Since there are 4 people, not 3, divide the remaining pizza by 4.

个,
4800
3. Alexander is taking 15 credit-hours this semester at college. The
relationship between tuition and credit hours is shown by the graph below.
What is the constant of proportionality?
A. 15
B. 400
C. 800
D. 6000
4400
4000
3600
3200
2800
2400
2000
Tuition
1600
1200
800
400
2
3
S
4
Credit Hours
7
&
9

Answers

Answer:

4800

3. Alexander is taking 15 credit-hours this semester at college. The

relationship between tuition and credit hours is shown by the graph below.

What is the constant of proportionality?

A. 15

B. 400

C. 800

D. 6000

4400

4000

3600

3200

2800

2400

2000

Tuition

1600

1200

800

400

2

3

S

4

Credit Hours

7

&

9

Step-by-step explanation:

What is the quotient of the following division problem?
71= 2 = ?
O A. 37 11
B. 35r1
O C. 35r2
O D. 34 r1

Answers

Answer:

35 remainder 1

Step-by-step explanation:

71 ÷ 2 = 35.5

The 35 is the whole number part of your answer. The .5 part of the answer is .5 of 2, which is 1

OR you can think that

35 × 2 =70. The 1 is the remaining part from 71.

A hose fills a pool up at a rate of 15 gallons every 2 hours. At this rate how many
gallons of water will be in the pool in 24 hours?

Answers

Answer:

there will be 180 gallons of water in the pool after 24 hours

Step-by-step explanation:

[tex]\frac{15}{2} *\frac{12}{12}= \frac{180}{24}[/tex]

Answer:

180 gallons

Step-by-step explanation:

Ok so,

2 hours = 15 gallons.

if we multiply both sides by 12 we can find out how many gallons of water will be in the pool in 24 hours

2 x 12 = 24

15 x 12 = 180

There will be 180 gallons of water in the pool after 24 hours.

find the angle of rotation that maps point D onto point A

Answers

Answer:

A - 144

Step-by-step explanation:

everything else would be too far

LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor )

Answers

A' = (4,0)
B' = (4,4)

Latex paint sells for $21 per gallon and will cost you $210 to paint your room. If each gallon will cover 300 square feet, how many square feet of wall space do you have in your room?

square feet

Answers

Answer: 3000 square feet

Step-by-step explanation: 21x10=210 .     300x10=3000

How do you solve this?

2x + 16y = -8
x + 8y = 7

The answer’s choices are no solution or infinite solution. please help.

Answers

Answer:

NO SOLUTION

Step-by-step explanation:

By the give me brainlist please

Find the value of x need help

Answers

Answer:

x = -8

Step-by-step explanation:

Angle 2 would be the same as 139

thus if angle 2 = x+147

then

139 = x + 147

x = -8

A rectangle that measures 10 inches by 7 inches.

Which expression will determine the perimeter, in inches, of the rectangle?

Answers

Answer:

( 2 x 10 ) + ( 2 x 7)

Step-by-step explanation:

Hope this helped!

Answer: 34 inches  Perimeter = 2L + 2W

Step-by-step explanation:

A rectangle has two sets of equal side lengths.    We'll assign 10 inches to the length, L, and 7 inches to the width, W.

The perimeter of a rectangle is 2L + 2W

Perimeter, P = 2(10) + 2*(7)

P = 20 + 14

P = 34 inches

Two rectangles are similar. The first has a length of 5cm and a width of 2cm. The second rectangle is an enlargement using a scale factor of 3. What will be the perimeter of the larger rectangle??
Group of answer choices

30 cm

4.666666667 cm

42 cm

21 cm

Answers

Answer:

C.) 42 cm

Step-by-step explanation:

When you enlarge the rectangle by a scale of 3, you are multiplying its perimeter by 3

2*2+5*2=4+10=14

14*3=42

Find the Product of 7/9of27

Answers

189 /9

7 x 27               189

              =    -------------------

9 x 1                     9

Kyla earns a commission. She makes 2.5% of the amount she sells. Last week, she sold
$3,500 worth of furniture. How much was her commission?

Answers

Answer:

$87.50

Step-by-step explanation:

Can someone please help me.

Answers

Answer:

make that 30 percent int a fraction and u should know what to do

Step-by-step explanation:

Write a multiplication equation that represents the question: how many 2/3 are in 9/8?

Answers

how many 2/3 are in 9/8?

or another way to put it will be

how many times does 2/3 go into 9/8?

well, is simply a division.

[tex]\cfrac{9}{8}\div \cfrac{2}{3}\implies \cfrac{9}{8}\cdot \cfrac{3}{2}[/tex]

Use the function below to find f(-2).
f(x) = 5x
O A. -25
O B. 1/10
O c. 1/25
O D. -10

Answers

Answer: is c. 1/25

the question is a year old but thought i'd help out and answer it since i just took the test on a.pex and the only other answer to the question is wrong

The value of the function f(2) is -10.

Option D is the correct answer.

What is a function?

A function has an input and an output.

A function can be one-to-one or onto one.

It simply indicated the relationships between the input and the output.

Example:

f(x) = 2x + 1

f(1) = 2 + 1 = 3

f(2) = 2 x 2 + 1 = 4 + 1 = 5

The outputs of the functions are 3 and 5

The inputs of the function are 1 and 2.

We have,

To find f(-2), we need to substitute -2 for x in the function f(x) = 5x:

So,

f(-2) = 5(-2) = -10

Therefore,

The value of the function f(2) is -10.

Learn more about functions here:

https://brainly.com/question/28533782

#SPJ7

Question One:
An Internet-based company that sells discount accessories for cell
phones often ships an excessive number of defective products. The
company needs better control of quality. Suppose it has 20 identical
car chargers on hand but that 5 are defective. If the company decides
to randomly select 10 of these items, what is the probability that 2 of
the 10 will be defective?

Answers

Probability that 2 of the 10 chargers will be defective =0.35

Number of ways of selecting 10 chargers from 20 chargers is 20C10

20C10 = 184756

Number of ways of selecting 10 chargers from 20 = 184756

Number of ways of selecting 2 defective chargers from 5 defective chargers = 5C2

5C2 = 10

Since 2 defective chargers have been chosen, there remains 8 to choose

Number of ways of selecting 8 good chargers from 15 remaining chargers = 15C8

Number of ways of selecting 8 good chargers from 15 remaining chargers = 6435

Probability that 2 of the 10 will be defective =

(10x6435)/184756

Probability that 2 of the 10 will be defective = 64350/184756

Probability that 2 of the 10 chargers will be defective =0.35

Learn more on probability here: https://brainly.com/question/24756209

Convert the following fraction to a decimal.

Answers

I think it’s C but I could be wrong but I don’t think I am

help me plssssssssssssssssssss

Answers

Answer:

multiply by 2

Step-by-step explanation:

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5'


Type of mutation (3pts):


Amino acid ( 3pts):


Type of mutation ( 3pts):


4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5'


Type of mutation ( 3pts) :


Amino acid ( 3pts):


Type of mutation ( 3pts):

Answers

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

tyr - arg - leu - leu - leu - arg - ala - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

Write the percent as fraction or mixed number in simplest form 34%

Answers

Answer: 34/100

Step-by-step explanation:

it is 34% out of 100, so it is 34/100. Reduced is 17/50

Tropical dried fruit costs $1.50 per pound and regular dried fruit costs $0.90 per pound. You want to create a mixed bag of tropical dried fruit and regular dried fruit that is worth $1.30 per pound. How many pounds of tropical dried fruit do you need if you have already purchased 50 pounds of regular dried fruit?

Answers

t = total amount of lbs of Tropical dried fruit

m = total amount of lbs of mixed bag

[tex]\begin{array}{lcccl} &\stackrel{fruit}{lbs}&\stackrel{per~lb}{price}&\stackrel{total}{price}\\ \cline{2-4}&\\ \textit{tropical fruit}&t&1.50&1.5t\\ \textit{regular fruit}&50&0.90&45\\ \cline{2-4}&\\ \textit{mix bag}&m&1.30&1.3m \end{array}~\hfill \begin{cases} t+50=m\\ 1.5t+45=1.3m \end{cases} \\\\[-0.35em] ~\dotfill[/tex]

[tex]\stackrel{\textit{substituting on the 1st equation}}{1.5t+45=1.3\stackrel{m}{(t+50)}}\implies 1.5t+45=1.3t+65\implies 0.2t+45=65 \\\\\\ 0.2t=20\implies t=\cfrac{20}{0.2}\implies \boxed{t=100}[/tex]

what is the slope of the line?

Answers

Answer:

1/2

Step-by-step explanation:

We can use the slope formula to find the slope

m = ( y2-y1)/(x2-x1)

We have two points on the line

(-1,3) and ( 1,4)

m = ( 4-3)/(1 - -1)

   = (4-3)/(1+1)

    = 1/2

Answer:

Start where the line meets a point. Then go up and over until it meets another.

The answer is 1/2

So go up one and over two. Then other problems such as this one should be pretty straight forward

I wish this was free ✋

Answers

Answer: It is tho ?

Step-by-step explanation:

4. This diagram is a straightedge and compass construction of a line perpendicular to line AB passing through point C. Which segment has the same length as segment EA.

a. EC

b. ED

C. BE

d. BD​

Answers

Answer:

Segment ED has the same length as EA

The line segment which is equal to EA is ED. Therefore, option B is the correct answer.

In the given diagram, a line perpendicular to line AB passes through point C.

What is the tangent to the circle?

A tangent to a circle is a line which intersects the circle at only one point. The common point between the tangent and the circle is called the point of contact.

The length of two tangents drawn from an external point to a circle is equal.

From the given figure we can see there are three circles, two large circles and one small circle.

Line segment EA is tangent to a small circle.

The line segment which is equal to EA is ED because ED is another tangent to a small circle from the same external point.

The line segment which is equal to EA is ED. Therefore, option B is the correct answer.

To learn more about the tangent to a circle visit:

https://brainly.com/question/16592747.

#SPJ2

William has $22 to buy strings for his guitar. Each set of strings costs $5.
How many sets of strings can he buy? Do not include units in your answer.
Answer here
SUBMIT

Answers

Answer:

4

Step-by-step explanation:

4 sets of strings will cost:

4×5=20

He will have $2 left over. Not enough to buy another set.

Or 5x<=22 DIVIDE BOTH SIDES BY 5

x <= 4.4 since he cannot buy .4 sets (this is a fraction of a set) He can only buy 4 sets

Find an equation of the plane.
The plane that contains the line
x = 3 + 2t,

y = t,

z = 6 − t
and is parallel to the plane
2x + 4y + 8z = 16

Answers

Answer:

  x +2y +4z = 27

Step-by-step explanation:

The parallel plane will have the same coefficients of x, y, z as the given plane. We notice those have a common factor of 2, so the equation can be reduced to ...

  x +2y +4z = constant

This equation is satisfied for every point on the line, so we have ...

  (3 +2t) +2(t) +4(6 -t) = constant . . . . . substituting for x, y, z

  3 +2t +2t +24 -4t = constant

  27 = constant

The equation of the desired plane is ...

  x +2y +4z = 27

The normal to the given plane is (2, 4, 8), and the plane we want is parallel to this one so it has the same normal vector.

When t = 0, the given line, and thus the plane we want, passes through the point (3, 0, 6).

Then the equation of the plane is given by

(2, 4, 8) • (x - 3, y - 0, z - 6) = 0

2 (x - 3) + 4y + 8 (z - 6) = 0

2x + 4y + 8z = 54

or

x + 2y + 4z = 27

Which of the following is equivalent to [picture]

A) a0 + a1 + a2 + a3 + a4 + a5

B) a1 + a2 + a3 + a4 + a5

C) a0 + a1 + a2 + . . .

D) a1 + a2 + a3 + . . . + a∞

Answers

Answer:

A) a0 + a1 + a2 + a3 + a4 + a5

Step-by-step explanation:

Answer:

A) a0 + a1 + a2 + a3 + a4 + a5

Step-by-step explanation:

Complete the table of ordered pairs for the linear equation

Answers

Answer:

Step-by-step explanation:

See attachment.

Other Questions
y=-2x-3y=2x-1y=x+ 4y=-x+ 2y=-2x-3y= x+ 4y=2x-1y=-x+ 2match with WXYZ Do you think people differ much according to the part of the country they live in? Why? I need help asap very struggle with math if your leg get cut off, where would you feel the pain if you got no leg. hehehe 1 Answer: Can function as a main verb; formed by adding -ing to the base verb a. present participle c. gerund b. past participle d. infinitive2 Answer: Formed with the word TO together with a base verb a. present participle c. gerund b. past participle d. infinitive3 Answer: Functions as a noun; formed by adding -ing to the base verb a. present participle c. gerund b. past participle d. infinitive4 Answer: Can function as an adjective; usually formed by adding -ed to the base verb a. present participle c. gerund b. past participle d. infinitive5 Answer: Select the letter of the term in the following list that identifies the underlined word or words in the sentence: Some tourists enjoy sketching foreign scenes. a. present participle c. gerund b. past participle d. infinitive6 Answer: Select the letter of the term in the following list that identifies the underlined word or words in the sentence: Matthew got out his canvas and oils and got ready to paint. a. present participle c. gerund b. past participle d. infinitive7 Answer: Select the letter of the term in the following list that identifies the underlined word or words in the sentence: Painting can be a relaxing hobby. a. present participle c. gerund b. past participle d. infinitive8 Answer: Select the letter of the term in the following list that identifies the underlined word or words in the sentence: The swaying motion of the trees was hard to suggest on canvas. a. present participle c. gerund b. past participle d. infinitive9 Answer: Select the letter of the term in the following list that identifies the underlined word or words in the sentence: Dabbing paint onto his brush, the artist set to work on a new painting. a. present participle c. gerund b. past participle d. infinitive10 Answer: Select the letter of the term in the following list that identifies the underlined word or words in the sentence: Overwhelmed, Micaela stared at the beautiful portrait. a. present participle c. gerund b. past participle d. infinitive11 Answer: Select the letter of the term in the following list that identifies the underlined word or words in the sentence: This watercolor, completed in 1924, is exceptionally well done. a. present participle c. gerund b. past participle d. infinitive12 Answer: Select the letter of the term that identifies each underlined phrase: The statue erected here honors a former mayor of the city. a. participial phrase c. infinitive phrase b. gerund phrase d. prepositional phrase13 Answer: Select the letter of the term that identifies each underlined phrase: Sculpting in stone requires skill and patience. a. participial phrase c. infinitive phrase b. gerund phrase d. prepositional phrase14 Answer: Select the letter of the term that identifies each underlined phrase: That sculptor has donated much of his work to the museum. a. participial phrase c. infinitive phrase b. gerund phrase d. prepositional phrase15 Answer: Select the letter of the term that identifies each underlined phrase: To see the famous statues of Italy has always been one of Gil's dreams. a. participial phrase c. infinitive phrase b. gerund phrase d. prepositional phrase16 Answer: Select the letter of the term that identifies each underlined phrase: This statue, made of marble, was sculpted by the great Michelangelo. a. participial phrase c. infinitive phrase b. gerund phrase d. prepositional phrase17 Answer: Select the letter of the term that identifies each underlined phrase: Our fine arts instructor very much enjoys teaching us about sculpture. a. participial phrase c. infinitive phrase b. gerund phrase d. prepositional phrase18 Answer: Select the letter of the term that identifies how the underlined word or phrase functions in the sentence: Those women are hooking rugs with complex designs. a. subject c. adjective b. direct object d. part of a verb phrase19 Answer: Select the letter of the term that identifies how the underlined word or phrase functions in the sentence: Dyeing the yarn for the rugs is a tedious and messy process. a. subject c. adjective b. direct object d. part of a verb phrase20 Answer: Select the letter of the term that identifies how the underlined word or phrase functions in the sentence: Abdul wants to show us his antique rugs. a. subject c. adjective b. direct object d. part of a verb phrase After a power failure, the temperature in a freezer increased at an average rate of 3.5 F per hour. The totalincrease was 10.5 F. Enter and solve an equation to find the number of hours until the power wasrestored. Let x represent the number of hours it takes for the temperature to increase to 10.5 F. An LED is useful because when a current passes through it, it gives out... what?Enter your answer organizing towns and town meetings For the point P(-25,10) and Q,(-18,15) find the distance d(P,Q) and the coordinates of the midpoint M of the segment PQ. Why was the middle colonies climate important how many people have died from the omicron variant? Consider the meaning of the word "dominate and that the Latin prefix pre-canmean "in front of." Use that information and the context clues provided in thepassage to determine the meaning of predominating. Write your definition ofpredominating here and tell how you determined its meaning. Danyon just finished a project. She wants to thank all the team members and collect their feedback on the overall project. What is the best approach to accomplish this?. Project planning output is :A. Top-down planningB. Bottom up planningC. Waterfall planningD. Iterative planning Explain how the Mayans, Aztecs, and Incas were advanced for their time for introduction Normal human sex cells have 23 chromosomes. Use the art to determine the number of chromosomes a sex cell may have if the nondisjuction occured during Meiosis I. Include all possible chromosome totals. 4. What is the message of the German cartoon? 4 An increase in the elderly share of the total population is ageing. Explain. Pls help pls help its my last question Identify the error in the following sentence and the best way to fix it.We adopted a kitten last year this year we got a dog.O A. It has a comma splice and needs a conjunction,O B. It is a fragment and needs a verb.O C. It is a run-on sentence and needs a period or semicolon.O D. It is a fragment and needs a subject.