Describe how the Georgia colony changed when it transitioned into a royal colony.

Answers

Answer 1

Answer:

The transition to a royal colony brought significant changes to the governance and society of Georgia. Some of these changes include:

Increased British control: With the transition to a royal colony, the British Crown assumed direct control over the colony. This meant that the governor and other colonial officials were appointed by the Crown rather than being elected by the colonists.

Expansion of slavery: Under Oglethorpe's leadership, slavery was initially prohibited in the Georgia colony. However, when Georgia became a royal colony, the ban on slavery was lifted, and the colony became heavily dependent on slave labor for its economic success.

Growth of plantations: The transition to a royal colony led to the expansion of large-scale plantation agriculture, particularly the production of rice and indigo. This created a hierarchical society in which wealthy plantation owners held significant political and economic power.

Restrictions on land ownership: The British Crown imposed new restrictions on land ownership, which made it more difficult for small farmers and settlers to acquire land. This led to increased tensions between the colonists and the British authorities.

Increased trade: With the backing of the British government, the Georgia colony was able to expand its trade with other British colonies and with Europe. This led to increased economic growth and prosperity for some segments of society.

Overall, the transition of the Georgia colony from a proprietary to a royal colony brought significant changes to the governance, society, and economy of the colony. While some aspects of the transition led to economic growth and prosperity, it also created new inequalities and restrictions that impacted the lives of many colonists.

Explanation:

Answer 2

Answer:

The transition to a royal colony brought significant changes to the governance and society of Georgia. Some of these changes include:

Increased British control: With the transition to a royal colony, the British Crown assumed direct control over the colony. This meant that the governor and other colonial officials were appointed by the Crown rather than being elected by the colonists.

Expansion of slavery: Under Oglethorpe's leadership, slavery was initially prohibited in the Georgia colony. However, when Georgia became a royal colony, the ban on slavery was lifted, and the colony became heavily dependent on slave labor for its economic success.

Growth of plantations: The transition to a royal colony led to the expansion of large-scale plantation agriculture, particularly the production of rice and indigo. This created a hierarchical society in which wealthy plantation owners held significant political and economic power.

Restrictions on land ownership: The British Crown imposed new restrictions on land ownership, which made it more difficult for small farmers and settlers to acquire land. This led to increased tensions between the colonists and the British authorities.

Increased trade: With the backing of the British government, the Georgia colony was able to expand its trade with other British colonies and with Europe. This led to increased economic growth and prosperity for some segments of society.

Overall, the transition of the Georgia colony from a proprietary to a royal colony brought significant changes to the governance, society, and economy of the colony. While some aspects of the transition led to economic growth and prosperity, it also created new inequalities and restrictions that impacted the lives of many colonists.

Explanation:

Answer 3

The change of Georgia to a royal colony had a drastic effect on its agricultural output and economy.

Georgia transitioned into a royal colony in 1752. Georgia was an agent colony that was governed by a board of directors. There was a trustee system in which people could not buy land and if they had, they could not sell it for their profit. The population was much smaller in comparison to other colonies.

The change to a royal colony brought a dramatic change to Georgia. With the availability of land for sale, the population of the state increased. This was seen as an opportunity by many wealthy planters as they grabbed large tracts of land for plantations.

Slavery which was earlier prohibited was now permitted and the number of slaves increased from 500 to 18,000 within just five years. Profits increased by a great deal for the minorities of the state. The political arrangement was also transitioned to a better form of government that was more representative.

A legislative body comprising citizens elected by rich landowners was created. Courts were established to settle disputes. With all these changes, the population of Georgia grew and the economy prospered in a way that was not possible during the period of trustees.

To learn more about Georgia and royal colonies;

https://brainly.com/question/11082045

Answer 4

The change of Georgia to a royal colony had a drastic effect on its agricultural output and economy.

Georgia transitioned into a royal colony in 1752. Georgia was an agent colony that was governed by a board of directors. There was a trustee system in which people could not buy land and if they had, they could not sell it for their profit. The population was much smaller in comparison to other colonies.

The change to a royal colony brought a dramatic change to Georgia. With the availability of land for sale, the population of the state increased. This was seen as an opportunity by many wealthy planters as they grabbed large tracts of land for plantations.

Slavery which was earlier prohibited was now permitted and the number of slaves increased from 500 to 18,000 within just five years. Profits increased by a great deal for the minorities of the state. The political arrangement was also transitioned to a better form of government that was more representative.

A legislative body comprising citizens elected by rich landowners was created. Courts were established to settle disputes. With all these changes, the population of Georgia grew and the economy prospered in a way that was not possible during the period of trustees.

To learn more about Georgia and royal colonies;

https://brainly.com/question/11082045


Related Questions

The Jackson--Vanik Amendment restricted trade with countries that denied ______ to its citizens.

a. free speech

b. democratic elections

c. educational opportunities

d. emigration rights

Answers

d. emigration rights

Designed primarily to protest Soviet restrictions on the USSR's Jewish population, the Jackson-Vanik Amendment (which passed unanimously in both houses of Congress) appealed to broadly shared American beliefs about freedom and mobility. At the same time, it united critics of détente from both sides of the political aisle. Conservatives who felt that Kissinger was accommodating the spread of communism joined liberals who felt that he was turning a blind eye to abuses of individual rights. The specific right of Soviet Jews to emigrate became a rallying cry and a launching pad for a number of political developments that emerged in the 1970s: renewed anti-communism, revived American Jewish identity, and a new global movement to hold national governments accountable to universal standards of human rights.

Which part of the economy is represented by box C on the circular flow model?

Answers

Answer:the market for goods and services. Firms supply goods and services to the households

Explanation:

A student found the solution below for the given inequality. |x-9|<-4 x-9>4 and x-9<-4 x> and x>13 and x <5 Which of the following explains whether the student is correct? The student is completely correct because the student correctly wrote and solved the compound inequality. The student is partially correct because only one part of the compound inequality is written correctly. The student is partially correct because the student should have written the statements using “or” instead of “and.” The student is completely incorrect because there is “ no solution “ to this inequality.

Answers

If a student found the solution below for the given inequality. The statement that explains whether the student is correct is; D. The student is completely incorrect because there is no solution to this inequality.

Which of the following explains whether the student is correct?

The given inequality is |x-9| < -4. However, the absolute value of any real number is always nonnegative. That is, |x-9| ≥ 0 for all x. Therefore, it is impossible for |x-9| to be less than -4.

Thus, there is no solution to this inequality, and the student's work is incorrect. None of the answer choices provided correctly explain the student's error.

Therefore the correct option is D.

Learn more about inequality here:https://brainly.com/question/24372553

#SPJ1

Since the nineteenth century, nationalism as largely replaced regional identity in the United States.

Answers

It is a false statement that since 19th century, nationalism as largely replaced regional identity in the United States.

Did nationalism fully replace regional identity?

Although nationalism become an important aspect of American identity during 19th century, the regional identity has persisted and remains an important part of the country's cultural landscape.

These regional differences in language, food, music, and other cultural practices still continue to be celebrated and preserved in various parts of the country. Also, the political divisions based on regioni n the North-South divide have continued to play a role in American politics.

Read more about nationalism

brainly.com/question/1287645

#SPJ1

In 1979 during a second energy crisis, President Carter retreated to Camp David to ______.

a. consult with scientists on alternative energy sources

b. meet with NATO leaders about pressuring OPEC nations to reduce oil costs

c. meet with business leaders about lowering energy needs and driving up production

d. reflect on the psychological and spiritual dimensions of the economic crisis

Answers

d. reflect on the psychological and spiritual dimensions of the economic crisis

In July 1979, as inflation soared and another OPEC price increase plunged the United States into a second energy crisis, Carter retreated to Camp David to reflect on the nation's problems. Rather than consulting with economists or geologists to devise a new energy policy, the president invited some 130 clergy, community leaders, academics, businesspeople, and others to help him reflect on the psychological and spiritual dimensions of the economic crisis. Speaking on national television after this retreat, Carter outlined a series of energy initiatives. More memorably, however, he insisted that the United States was facing a "crisis of confidence." As Carter saw it, Americans no longer believed they could contribute positively to their own government and no longer looked optimistically to the future. They had also become distracted by materialistic desires. "Owning things and consuming things," he proclaimed, sounding like a preacher, "does not satisfy our longing for meaning.”

Human poverty encompasses which of the following elements?

Answers

Human poverty refers to a condition in which individuals or communities lack access to the basic necessities of life, including food, clean water, shelter, healthcare, education, and economic opportunities.

What is poverty?

When people are in a state of poverty, they are unable to meet their fundamental needs for things like food, water, housing, clothing, and medical care. It is a complex issue that can take many different forms, including income poverty, poverty in the educational system, poverty in the health sector, and social exclusion. Economic disparity, lack of access to healthcare and education, unemployment, and prejudice are only a few of the causes of poverty.

Low levels of education, poor health outcomes, and restricted economic possibilities are all common consequences of poverty. It is a complicated issue that calls for all-encompassing and ongoing efforts to address its underlying causes and lessen its effects on people, families, and communities.

Poverty can be measured and understood in multiple dimensions, including income, health, education, and access to basic services.

Learn more on poverty here https://brainly.com/question/20702315

#SPJ1

"Our mission in Afghanistan has taken many missteps- made many missteps over
the past two decades."
Which type of framing illusion is being used in this speech on the US withdrawal
from Afghanistan?
A.Juxtaposition
B.Normative Descriptors
C.Qualifiers of Uncertainty
D.Agent deletion

Answers

Answer: The answer is C. Qualifiers of Uncertainty.

Explanation: The phrase "taken many missteps" implies that the speaker is uncertain about the effectiveness of the mission in Afghanistan and acknowledges that mistakes were made. The qualifier "many" further emphasizes this uncertainty and implies that there were numerous missteps taken over a long period of time. This framing illusion is an example of Qualifiers of Uncertainty, which is a common way that speakers use language to hedge their statements and express doubt or uncertainty about a particular topic.

Opposition from which group helped defeat the passage of the Equal Rights Amendment in 1972?

a. labor unions

b. radical feminists

c. religious conservatives

d. business leaders

Answers

c. religious conservatives

Religious opposition had been crucial to the outcome of the ERA debate. Schlafly's STOP ERA and Beverly LaHlaye's Concerned Women for America (founded in 1979) had attracted significant support from evangelical women, as well as from conservative Catholics and Mormons. The states that blocked the amendment included most of the South, where the evangelical movement was strongest, and three Western states (Utah, Nevada, and Arizona) where Mormons had considerable voting power. These religious conservatives saw the ERA as a broad cultural threat that went beyond the danger to homemakers. In 1972, Schlafly had also founded the Eagle Forum, a political organization that linked ERA opposition to anti-abortion activism and a host of other causes associated with the idea of family values.

What level of government levies sales tax?

a. state
b. federal
c. community
d. local

The answer is STATE GOVERMENT

Answers

Answer:

state government

Explanation:

What factors fueled deindustrialization in the early 1970s?

- Employees began migrating to other sectors of the economy.

- Labor unions had become too powerful.

- Consumer demand had declined.

- U.S. industry faced more foreign competition.

Answers

- Employees began migrating to other sectors of the economy.
- U.S. industry faced more foreign competition.

National rates of economic misery masked the fact that certain regions and populations were hit much harder than others. Job losses were heaviest in the manufacturing sectors of the Northeast and Midwest. These regions-economic powerhouses in earlier periods-bore the brunt of the United States's decline as an industrial manufacturer in the face of foreign competition. The impact of deindustrialization on older U.S. cities during this era was staggering. Between 1967 and 1987, manufacturing jobs in Chicago dropped by 60 percent and in New York by 58 percent. Many jobs simply disappeared as factories shut down or relocated to other parts of the world. At the same time, employment was migrating to other sectors of the economy, such as service work. Jobs were also drawn to warmer parts of the country, especially Southern and Western states where right-to-work laws lowered labor costs by prohibiting collective bargaining contracts that required companies to hire union members.

According to a Damon Linker article (Aug 31, 2021), "The South has long produced
an abundant supply of populist anger and resentment."
This statement can be considered an example of which two propaganda strategies?
A.Appeal to Outgroup Homogeneity
B.Ipse Dixit
C.Sweeping Generalization
D.Sanitizing

Answers

The statement "The South has long produced an abundant supply of populist anger and resentment" can be considered an example of the propaganda strategy known as a sweeping generalization.

What is Sweeping Generalization?

In this case, the author is making a broad and generalized statement about an entire region of the country, the South, without providing specific evidence or examples to support the claim.

There is no indication that the statement is an example of the propaganda strategy of Appeal to Outgroup Homogeneity or Ipse Dixit.

Appeal to Outgroup Homogeneity is a propaganda technique that involves suggesting that members of a particular group are all the same, while Ipse Dixit is a propaganda technique that involves relying on the speaker's authority or expertise rather than providing evidence or reasoning. Neither of these propaganda strategies is evident in the statement provided.

Sanitizing is a propaganda technique that involves using language to make something sound more positive or neutral than it really is. This is also not evident in the statement provided.

Learn more about Sweeping Generalization here:https://brainly.com/question/12157094

#SPJ1

why was the industries in trouble before the depression

Answers

Explanation:

the most dangerous jobs

Although the seventh branch of the municipal police station has a close relationship with the community, the crime data is still higher than in previous years.

Answers

The reasons behind the increase in crime data despite the close relationship between the seventh branch of the municipal police station and the community include increase in population, changes in criminal activity, inadequate resources, and socioeconomic factors.

Reasons behind high crime rate

The reasons behind the increase in crime data despite the close relationship between the seventh branch of the municipal police station and the community. Some possible reasons could be:

Population growth: The crime rate will inevitably rise as the population grows. The sheer volume of people can promote crime even when the police are executing their jobs well.

Criminal activity changes: Criminals may modify their tactics, making it harder for the authorities to stay up. For instance, the emergence of cybercrime might be more difficult to stop than more conventional types of crime.

A lack of resources could prevent the police from effectively combating local crime. This can be the result of personnel shortages or budget cuts.

Socioeconomic factors: Conditions like poverty, unemployment, and social inequality can have an impact on crime rates. If the community that the seventh branch serves is dealing with these problems, it can cause crime to increase.

Learn more on municipal police station here https://brainly.com/question/30153077

#SPJ1

What events leading to the civil war made the most difference in the outcome

Answers

The election of President Abraham Lincoln in 1860 delivered on the secession of most slave-holding states and propelled the united states of the united states into civil war.

What healthy used to be the quintessential motive of the Civil War?

At 4:30 a.m. on April 12, 1861, Confederate troops fired on Fort Sumter in South Carolina's Charleston Harbor. Less than 34 hours later, Union forces surrendered. Traditionally, this match has been used to mark the organising of the Civil War.

The United States Civil War, fought between 1861 and 1865, featured many integral and minor engagements, and navy actions. Among the most large have been the First Battle of Bull Run, the Battle of Shiloh, the Battle of Antietam, the Battle of Gettysburg, and the Vicksburg Campaign.

Learn more about Civil War here:

https://brainly.com/question/24992590#SPJ1

The USA is not exclusively capitalist because the government sometimes pays farmers to not plant. This is a type of:
•TANF
•Farm Price Support
• Replenishment Fund
• Fallow Offset

Answers

The type of government program that pays farmers to not plant is called Farm Price Support, which is a type of agricultural subsidy.

Option B is correct

This subsidy is designed to help stabilize crop prices and ensure that farmers have a reliable income, even during times of oversupply or low market demand.

The program provides payments to farmers who agree to reduce their crop production or leave some of their fields fallow, thus reducing the overall supply and potentially driving up prices. This program is an example of how the US government intervenes in the economy to support certain industries and promote economic stability, which is not exclusive to capitalism but rather a characteristic of mixed economies.

Option B is correct

To know more about Farm Price Support here

https://brainly.com/question/27894163

#SPJ1

"My uncle heard the drug ivermectin prevents COVID-19. The treatment works! He
took ivermectin, and didn't get COVID."

The above statement is an example of which logical fallacy?

A.Appeal to relative privation
B.Post hoc ergo propter hoc
C.Tu quoque ("You too") argument
D.Ad hominem

Answers

Answer:

B. Post hoc ergo propter hoc (meaning "after this, therefore because of this"). This is a fallacy that assumes that because one event occurred before another event, it must have caused the second event. In this case, the speaker is assuming that because the uncle took ivermectin and did not get COVID-19, the drug must have prevented the disease, without considering other factors that may have played a role.

Explanation:

1-What options are available when it comes to selecting a degree to prepare for a career in journalism?

2-Why is the willingness to take feedback and criticism an important trait for future journalists?

3-Why is a portfolio an important piece of your job search?

4-How does the role of a public relations specialist differ from other journalism positions?

5-Why could specializing in a niche be beneficial in journalism?

Answers

1. The capacity to receive feedback and criticism is a characteristic of extreme importance for budding journalists, allowing them to escalate their abilities by continuing their learning processes.

2-Why is the willingness to take feedback and criticism an important trait for future journalists?

Journalism is an ever-evolving practice necessitating accustomedness to modern technologies and audience preferences, while feedback from mentors, colleagues, or editors can deliver imperative hints concerning topics which demand improvement. Furthermore, being open towards feedback and criticism can help in assembling firmer ties with sources and readers.

3-Why is a portfolio an important piece of your job search?

When discussing the third inquiry, portfolios constitute a signficant part of any journalism job search; they demonstrate one's aptitudes and talents via auspicious writing pieces, multimedia content and other correspondent work making it suitable for a given position or business. An accomplished portfolio can assist a journalist make himself visible among numerous applicants, as well as displaying potential assestment to imminent employers.

4-How does the role of a public relations specialist differ from other journalism positions?

Answering the fourth query, the role of a public relations specialist deviates from that of ordinary reporters since its essentiality rests upon creating and ardently disseminating positive messages related to particular persons or organizations while also dealing with any negative press. The latter requires various aptitudes which differ from those used in everyday reporting due to its increased emphasis on persuasion and composition of messages instead of simpole objectivity.

5-Why could specializing in a niche be beneficial in journalism?

When attending the fifth question, specializing in a determinate niche can be profitable for journalists because of its capacity to build up great proficiency in certain areas leading to gainful writing arrangements, elevated salary rates and amplified career security. Niche specializations can also make one seem distinctive from his competitors and exhibit his value to the respective businessmen or readers.

Read more on Journalism here:https://brainly.com/question/1023239

#SPJ1

Can someone Plesssss help me?

Answers

Answer:

19th Amendment and the 15th Amendment to the United States Constitution

Explanation:

The 19th Amendment and the 15th Amendment to the United States Constitution helped women and African Americans, respectively, in terms of their rights to vote.

The 19th Amendment, ratified in 1920, granted women the right to vote, ensuring that gender could not be used as a basis for denying citizens the right to vote. This amendment was a significant victory for the women's suffrage movement and expanded the democratic process by allowing women to participate in elections.

The 15th Amendment, ratified in 1870, gave African American men the right to vote, prohibiting states from denying the right to vote based on race, color, or previous condition of servitude. Although the amendment did not explicitly mention gender, it provided a foundation for future civil rights movements that aimed to secure voting rights for all Americans regardless of gender or race.

Therefore, both the 19th and 15th Amendments helped to expand voting rights in the United States, benefiting women and African Americans in particular.

What legislation was an attempt to meet the needs of White constituents in the North and South?
O abolitionist societies
O Compromise of 1850
O Underground Railroad

Answers

The legislation that was an attempt to meet the needs of White constituents in the North and South was the Compromise of 1850.

This legislative package aimed to ease tensions between the Northern and Southern states over the issue of slavery. The compromise included several provisions, including the admission of California as a free state, the establishment of popular sovereignty in New Mexico and Utah, the abolition of the slave trade in Washington D.C., and the enactment of a tougher Fugitive Slave Law.

The Compromise of 1850 was primarily motivated by the desire to maintain the balance of power between free and slave states in the U.S. Congress. It also reflected the concerns of White constituents in both the North and South.

Northern constituents were worried about the spread of slavery into new territories, while Southern constituents feared that their economic and social systems would be threatened if slavery were abolished.

Despite its intentions, the Compromise of 1850 failed to ease tensions over slavery, and it ultimately contributed to the outbreak of the Civil War.

Learn more about Civil War here:

https://brainly.com/question/11874600

#SPJ1

explain the modern forms of slavery using libya as example.​

Answers

Answer:

In Libya, modern slavery is a widespread problem where migrants and refugees trying to reach Europe often become victims of exploitation and abuse. Many of these individuals, including women and children, are trafficked or forcibly held against their will, and are subjected to harsh conditions like overcrowded detention centers, lack of basic necessities, and physical and sexual violence.

One major issue in Libya is human trafficking, where traffickers take advantage of vulnerable migrants and refugees by promising them safe passage to Europe in exchange for money. However, once in Libya, these victims are often exploited, forced to work without pay, and may even be sold or traded multiple times.

Forced labor is another common form of modern slavery in Libya, where migrants and refugees are made to work in industries like agriculture or construction without proper pay or protection, and their passports are often confiscated, leaving them with little control over their own lives.

Efforts are being made by local and international organizations to combat modern slavery in Libya through advocacy, awareness-raising, and support for victims, as well as working with Libyan authorities to strengthen laws against human trafficking and forced labor. However, addressing this complex issue requires ongoing efforts and collaboration to ensure the safety and well-being of vulnerable migrants and refugees.

Explanation:

I am a city planner in Ukraine. I am in charge of rebuilding Mariupol and it is in ashes. What is my best plan to get former residents back home?

Answers

Answer: As a city planner in charge of rebuilding Mariupol, your best plan to get former residents back home would be to prioritize essential services such as water, electricity, and waste management, and to focus on creating job opportunities. You can achieve this by working with businesses to establish themselves in the area, providing tax incentives for new businesses, and investing in vocational training programs to help residents acquire the skills they need for available jobs. It is also important to provide affordable housing options for residents and to invest in infrastructure such as transportation to make the city more accessible. By taking these steps, you can create a strong foundation for the city's recovery and make Mariupol an attractive place for former residents to return to.

Explanation: I think that covers it.

According to a Damon Linker article (Aug 31, 2021), "The South has long produced
an abundant supply of populist anger and resentment."
This statement can be considered an example of which two propaganda strategies?
A.Ipse Dixit
B.Sanitizing
C.Appeal to Outgroup Homogeneity
D.Sweeping Generalization

Answers

The statement is an example of sweeping generalization because it makes a broad and overly simplified statement about an entire region of the United States without providing any specific evidence to support the claim.

What is Resentment?

Resentment is a feeling of bitterness, anger, or disappointment that arises when one feels unfairly treated. It can be directed towards a person, group, or situation and often arises from a perceived sense of injustice or unfairness. Resentment can lead to negative emotions and behaviors, such as anger, envy, and revenge, and can be detrimental to personal relationships and well-being if not addressed and resolved.

It is also an example of appeal to outgroup homogeneity because it suggests that people in the South are all the same in terms of their political beliefs and attitudes, and that those beliefs and attitudes are negative (i.e. populist anger and resentment). This creates an "us vs. them" mentality that can be used to rally support for a particular cause or group.

Learn more about Resentment from the given link

https://brainly.com/question/29490156

#SPJ1

How did the culture wars divide the US?

Answers

Answer:

The culture war or culture conflict refers to the conflict between traditionalist or conservative values and social democracy, progressive or social liberal values in the Western world, as well as other countries.

Cultural conflict is likely to emerge when the rules and values of one cultural group are substantially different from another, and members of the cultures come in contact with each other.

In American usage, "culture war" may imply a conflict between those values considered traditionalist or conservative and those considered progressive or liberal. This usage originated in the 1920s when urban and rural American values came into closer conflict.[7] This followed several decades of immigration to the States by people who earlier European immigrants considered 'alien'. It was also a result of the cultural shifts and modernizing trends of the Roaring '20s, culminating in the presidential campaign of Al Smith in 1928.[8] In subsequent decades during the 20th century, the term was published occasionally in American newspapers.[9][10]

1991–2001: Rise in prominence
Edit
James Davison Hunter, a sociologist at the University of Virginia, introduced the expression again in his 1991 publication, Culture Wars: The Struggle to Define America. Hunter described what he saw as a dramatic realignment and polarization that had transformed American politics and culture.

He argued that on an increasing number of "hot-button" defining issues—abortion, gun politics, separation of church and state, privacy, recreational drug use, homosexuality, censorship—there existed two definable polarities. Furthermore, not only were there a number of divisive issues, but society had divided along essentially the same lines on these issues, so as to constitute two warring groups, defined primarily not by nominal religion, ethnicity, social class, or even political affiliation, but rather by ideological world-views.

Hunter characterized this polarity as stemming from opposite impulses, toward what he referred to as Progressivism and as Orthodoxy. Others have adopted the dichotomy with varying labels. For example, Bill O'Reilly, a conservative political commentator and former host of the Fox News Channel talk show The O'Reilly Factor, emphasizes differences between "Secular-Progressives" and "Traditionalists" in his 2006 book Culture Warrior.[11][12]

Historian Kristin Kobes Du Mez attributes the 1990s emergence of culture wars to the end of the Cold War in 1991. She writes that Evangelical Christians viewed a particular Christian masculine gender role as the only defense of America against the threat of communism. When this threat ended upon the close of the Cold War, Evangelical leaders transferred the perceived source of threat from foreign communism to domestic changes in gender roles and sexuality.[13]


Pat Buchanan in 2008
During the 1992 presidential election, commentator Pat Buchanan mounted a campaign for the Republican nomination for president against incumbent George H. W. Bush. In a prime-time slot at the 1992 Republican National Convention, Buchanan gave his speech on the culture war.[14] He argued: "There is a religious war going on in our country for the soul of America. It is a cultural war, as critical to the kind of nation we will one day be as was the Cold War itself."[15] In addition to criticizing environmentalists and feminism, he portrayed public morality as a defining issue:

The agenda [Bill] Clinton and [Hillary] Clinton would impose on America—abortion on demand, a litmus test for the Supreme Court, homosexual rights, discrimination against religious schools, women in combat units—that's change, all right. But it is not the kind of change America wants. It is not the kind of change America needs. And it is not the kind of change we can tolerate in a nation that we still call God's country.[15]
A month later, Buchanan characterized the conflict as about power over society's definition of right and wrong. He named abortion, sexual orientation and popular culture as major fronts—and mentioned other controversies, including clashes over the Confederate flag, Christmas, and taxpayer-funded art. He also said that the negative attention his "culture war" speech received was itself evidence of America's polarization.[16]

The culture war had significant impact on national politics in the 1990s.[2] The rhetoric of the Christian Coalition of America may have weakened president George H. W. Bush's chances for re-election in 1992 and helped his successor, Bill Clinton, win reelection in 1996.[17] On the other hand, the rhetoric of conservative cultural warriors helped Republicans gain control of Congress in 1994.[18]



Did my best please give branliest

A model of a plate boundary is shown. What most likely happens as the plates slide past each other?

Answers

Answer:

When oceanic or continental plates slide past each other in opposite directions or move in the same direction but at different speeds, a transform fault boundary is formed. No new crust is created or subducted, and no volcanoes form, but earthquakes occur along the fault.

Explanation:

In response to the energy crisis of 1973--1974, Congress

- authorized the Department of Energy to temporarily take control of all gas stations.

- imposed daylight saving time for all of 1974.

- introduced a national speed limit of 55 miles per hour.

- increased federal investment in alternative energy sources.

Answers

- imposed daylight saving time for all if 1974.
- imposed a national speed limit if 55 miles.

Back home, the fallout from the energy crisis continued to rain down for the embargo's duration. Fifteen states and the District Page 733 of Columbia instituted gas rationing, and in some places, service stations simply stopped selling gasoline. To encourage conservation, Congress introduced a national speed limit of 55 miles per hour on interstate highways and imposed daylight saving time for all of 1974. The same year, NASCAR reduced the distances of all auto races by 10 percent. Responding to powerful pressures from an agitated populace, Congress took more aggressive measures, passing a mandatory fuel allocation bill to press large U.S. oil companies to lower their prices and to force them to sell to independent refiners and distributors. Although it was not the only symptom of a global economic downturn, the energy crisis introduced those Americans who had known only growth and prosperity to the concept of a shortage.

Evangelical preachers reached ever-wider audiences in the 1970s with the advent of ______.

a. Bible colleges

b. Christian cable television networks

c. Christian bookstores

d. Christian radio programs

Answers

b. Christian cable television networks

Evangelical Protestantism enjoyed a rebirth in the 1970s, comparable in some ways to the great religious revivals and awakenings of the eighteenth and nineteenth centuries. Evangelical denominations such as the Southern Baptist Convention grew quickly over the decade, whereas more liberal mainstream churches declined in membership. Some of the most spectacular growth took place among Pentecostals, both white and Black, and other evangelical churches not affiliated with larger ecclesiastical bodies. By 1976-"the year of the evangelical," according to Newsweek magazine more than one in three Americans identified themselves to pollsters as "born again or "evangelical" Christians. The same year, the United States elected Jimmy Carter, its first born-again president.

Personal evangelical faith often fit into a larger conservative world view, nurtured in an older network of institutions that included churches, Bible colleges, Christian booksellers, and campus groups. Evangelicalism in the 1970s also spread through new avenues, however. Among them were FM radio stations that catered specifically to born-again listeners and new cable television channels and satellite technology through which evangelical preachers reached ever-wider audiences. Reverend Pat Robertson's Christian Broadcasting Network, founded in 1961, launched its own cable network in 1977. By the end of the decade, Jerry Falwell's Old Time Gospel Hour was drawing more than 1.4 million viewers nationwide. Evangelical consumer goods also flourished, including contemporary Christian music and a booming publishing industry that sold over a billion dollars a year in Christian self-help books, fiction, theology, greeting cards, and other printed goods. Men and women uncomfortable with the secular values and sexual content of mainstream popular entertainment and literature flocked to a burgeoning alternative culture.

what is the biggest animal in the world​

Answers

Answer:

The blue whale (Balaenoptera musculus) is currently recognized as the largest animal in the world. It is a species of marine mammal belonging to the baleen whale suborder and can reach lengths of up to 100 feet (30 meters) and weigh as much as 200 tons. Blue whales are known for their massive size and impressive feeding behavior, primarily feeding on tiny shrimp-like animals called krill. Despite their enormous size, blue whales are filter feeders, and their diet consists almost entirely of these small organisms. Blue whales are found in various oceans around the world, and they are classified as endangered due to threats such as whaling, ship strikes, and habitat degradation.

It’s the antarctic blue whale

What the answer to this question in the photo

Answers

The above statement is and example of- D. Ad Hominem type of fallacious argument.

In the excerpt in the question, a person judges kids accused of setting fire to Wendy's and screaming at the TV all day. He refers to them as non sense people , without knowing the reason for their activities.

This shows Ad hominem type of fallacy as, This fallacy happens when you attack the person presenting the argument or some feature of them in an unrelated way rather than responding to their argument or viewpoint.

Hence, the correct answer is D.

Why is fallacy significant?

A error in an inductive argument weakens it but does not render it incorrect. It's crucial to understand fallacies so that you can steer clear of them while presenting your arguments.

You may evaluate and critique other arguments on the basis of your study of fallacies.

To know more about Fallacy visit:

https://brainly.com/question/899975

#SPJ1

The above statement is and example of- D. Ad Hominem type of fallacious argument.

In the excerpt in the question, a person judges kids accused of setting fire to Wendy's and screaming at the TV all day. He refers to them as non sense people , without knowing the reason for their activities.

This shows Ad hominem type of fallacy as, This fallacy happens when you attack the person presenting the argument or some feature of them in an unrelated way rather than responding to their argument or viewpoint.

Hence, the correct answer is D.

Why is fallacy significant?

A error in an inductive argument weakens it but does not render it incorrect. It's crucial to understand fallacies so that you can steer clear of them while presenting your arguments.

You may evaluate and critique other arguments on the basis of your study of fallacies.

To know more about Fallacy visit:

https://brainly.com/question/899975

#SPJ1

what are the situation under which the rights of the individual can be lawfully curtailed in Ghana​

Answers

Individuals' rights in Ghana may be legally restricted in the following situations National Security- When there is a threat to public safety or national security, the government may restrict individual rights.

Individual rights can also be restricted by the government in times of public health emergencies, such as an epidemic of an infectious disease. Individual rights may be restricted throughout the legal process in order to guarantee that justice is served. Detention, search and seizure, and other legal processes are examples of this. Limits imposed by legislation: Some constraints on individual rights, such as restrictions on freedom of speech or expression, may be imposed by law in order to safeguard public order and morality.

It is crucial to stress that any restriction of individual rights must be legal and in compliance with the Ghanaian Constitution and that people have the right to challenge such restrictions in court.

To learn more about  lawfully curtailed in Ghana

https://brainly.com/question/16589866

"In Japanese Management Style, members of the organization are controlled thru:"

• No means; people don't need to be controlled.
• financial incentives like salary or wage to keep members in line.
• Appeals to identity and identity change.
•The promise of potential spouses.

Answers

In Japanese Management Style, members of the organization are controlled through no means because  people don't need to be controlled.  Team work is encouraged.

Japanese Management Style

The term Japanization, which also applies to corporate methods and management strategies, is used to describe the Japanese management style. It is distinguished by a significant emphasis on collaboration, long-term planning, reaching consensus, ongoing improvement, and customer satisfaction.

The following are some essential components of the Japanese management style:

Japanese businesses place a high priority on quality control and inspection, which helps to guarantee that goods and services meet or exceed client expectations.

Kaizen: A fundamental tenet of Japanese management is continuous improvement. Employers urge staff to always seek out methods to enhance procedures, goods, and services.

Long-term outlook: Japanese businesses frequently have a long-term outlook, emphasizing the development of connections with clients, vendors, and staff members that can endure for many years.

Learn more on Japanese Management Style here https://brainly.com/question/30204380

#SPJ1

Other Questions
Sheridan Company is considering an investment that will return a lump sum of $929,000 6 years from now. CWhat amount should Sheridan Company pay for this investment to earn an 8% return? (Round answer to 2 decimal places, eg. 25.25.)Lincoln Company should pay $ ___Wildhorse Co.earns 8% on an investment that pays back $87,000 at the end of each of the next 6 years.What is the amount Wildhorse Co. invested to earn the 8% rate of return? (Round answer to 2 decimal places, eg. 5,275.25.) Wildhorse Co. invested $ ___ compare and contrast the expansionist policies of the russian state with those pursued by the british and french regimes during this period. let x have the following cumulative distribution function (cdf): f(x)={0,x Gary deposited $9,000 in a savings account with simple interest. Four months later, he had earned $180 in interest. What was the interest rat (conservation of mass) for a certain incompressible flow field it is suggested that the velocity components are given by the equations is this a physically possible flow field? Please help me with this (9/4x+6)-(-5/4x-24) A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 55 C. If an RNA duplex oligonucleotide of identical sequence, substituting U for T, is constructed, how will its melting temperature compare to that of its DNA counterpart? - The tm will be higher. - The effect on tm of replacing U for T cannot be predicted. - The tm will be lower. - The tm will be unchanged. The time it takes a mechanic to change the oil in a car is exponentially distributed with a mean of 5 minutes. (Please show work)a. What is the probability density function for the time it takes to change the oil?b. What is the probability that it will take a mechanic less than 6 minutes to change the oil?c. What is the probability that it will take a mechanic between 3 and 5 minutes to change the oil?d. What is the variance of the time it takes to change the oil? Which of the following statements is the best description of the per capita generation of solid waste between 1960 and 2010?ANSWER:a.Between 1960 and 2010, per capita generation was relatively constant.b.Between 1960 and 2010, per capita generation of solid waste increased steadily.c.Between 1960 and 2000, per capita generation increased.After 2000, per capita generation declined.d.Between 1960 and 1990, per capita generation increased at a steady rate. After 1990, per capita generation continued to increase, but at a slower rate. find the running time equation of this program: def prob6(l): if len(l) Parts of a watershed Reconsider the Fingroup Fund in the previous problem. If during the year the portfolio manager sells all of the holdings of stock D and replaces it with 200,000 shares of stock E at S50 per share and 200,000 shares of stock F at $25 per share, what is the portfolio turnover rate? Well-designed performance evaluation systems accomplish many goals. Consider the following actions and state which goal is being achieved by the action a. Comparing targets to actual resuits b. Providing subunit managers with performance targets c. Comparing actual results with industry standards d. Providing bonuses to subunit managers who achieve performance targets Communicating expectations Motivating segment managers Promoting goal congruence and coordination Providing foedback e. Aligning subunit performance targets with company strategyf. Comparing actual results of competitorsg. Taking corrective actions h. Using the adage "you get what you measure" when designing the performance evaluation system Choose from any drop-down list and then continue to the next question. consider the following differential equation to be solved by the method of undetermined coefficients. y(4) 2y y = (x 4)2 Rob and Ashley are riding their bicycles uphill. Currently, Rob is 5.7 km from the top and climbing at 0.24 km/min. Ashley is 4.5 km from the top and riding at 0.17 km/min. Estimate when Rob will be closer to the top than Ashley mong the following pairs of sets, identify the ones that are equal. (Check all that apply.) Check All That Apply (1,3, 3, 3, 5, 5, 5, 5, 5}, {5, 3, 1} {{1} }, {1, [1] ) 0.{0} [1, 2], [[1], [2]) Find the missing dimension of the parallelogram. As reported by the Department of Agriculture in Crop Production, the mean yield of oats for U.S. farms is 58.4 bushels per acre. A farmer wants to estimate his mean yield using an organic method. He uses the method on a random sample of 25 1-acre plots and obtained a mean of 61.49 and a standard deviation of 3.754 bushels. Assume yield is normally distributed.Refer to problem 2. Assume now that the standard deviation is a population standard deviation.a. Find a 99% CI for the mean yield per acre, :, that this farmer will get on his land with the organic method.b. Find the sample size required to have a margin of error of 1 bushel and a 99% confidence level? The mean of the following incomplete information is 16. 2 find the missing frequencies. Class Intervals10-12 12-14 14-1616-1818-20 20-22 22-24 TOTALFrequencies 5 ? 10 ? 9 3 2 50 CONCEPTUAL FRAME WORK