decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer 1

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong


Related Questions

3. Which process is most directly involved in the
production of egg cells by a female frog?

Answers

Answer questions ?.. forgot to put them

Asap

What examples of rocks do you see around you? How do you think they were formed?

Answers

Answer:

Some examples of rocks are sedimentary rocks and I think they were forms from deposited sediments that were eroded which is then compacted together

Explanation:

Answer:

Metamorphic rock, sedimentary rock and igneous rock are some examples of rocks I see around me. Marble is a metamorphic rock that is formed from sedimentary rock limestone, examples of sedimentary rocks include limestone, sandstone, chalk, coal, claystone and flint. Lastly, igneous rock is formed when magma cools and solidifies, it may do this above or below the Earth's surface to make basalt, granite, pumice, obsidian, tuff, diorite, gabbro or andesite.

Explanation:

This is completely original work feel free to use it!

Brainliest please! it would help out a lot

You are working in a lab trying to identify a single celled organism. You are not
sure if it is a Protist or a Moneran (Eubacteria or Archaebacteria). What test
would be most useful to determine its identity?
A. Put it in the sun and measure the oxygen levels
B. Determine if it is motile
C. Test its cells for chitin
D. Determine if it has a nucleus

Answers

The test that will be most useful to determine the identity of the single-celled organism is to "determine if it has a nucleus".

DIFFERENCE BETWEEN A PROTIST AND MONERAN:

A protist is a member of the kingdom protista characterized by it's single cells and eukaryotic nature.

On the other hand, a MONERAN is a member of the kingdom MONERA and characterized by it's unicellular and prokaryotic nature.

The major difference between Monera and protista is their prokaryotic and eukaryotic cells respectively. Prokaryotic cells do not have a membrane bound nucleus while an eukaryotic cell does.

Since the major difference between Monerans and protists is their possession of a membrane bound nucleus, the identity of the single-celled organism is to "determine if it has a nucleus".

Learn more: https://brainly.com/question/5144655

What happens to a mother offspring when a mutation is in her gamete cells

Answers

Answer: her child will have the mutation in all of his/her cells

Explanation:

Identify the converted product of the photosynthesis process.​

Answers

During the process of photosynthesis plants break apart the reactants of carbon dioxide and water and recombine them to produce oxygen (O2) and a form of sugar called glucose (C6H12O6).

help plsllsss

question on picture​

Answers

Answer:

Body temperature

Explanation:

Body temperature and blood glucose

PLEASE HURRY
Which pair of structures would provide a positive identification of an animal cell under a microscope?

flagellum, lysosome


nucleus, mitochondrion

ribosome, cell wall

chromatin, chloroplast

Answers

flagellum, lysosome: Both of these are found in animal cells, but the real difference is flagellum is ONLY found in animal cells

nucleus, mitochondrion: Both of these are found in Animal cells X

ribosome, cell wall: Cell wall is only in plants X

chromatin, chloroplast: Chloroplast is only found in plant cells X

Explanation:

Firstly cell wall and chloroplasts can only be found in plant cells and will not appear in an animal cell.

Flagellum usually appears in many bacteria (microorganism) and only a few animal cells. Most animal cells do not have flagellum.

However animal cells do have a nucleus which contains important genetic material such as DNA and mitochondrion which creates energy for the cell to use for metabolism inside the cell. (Even though most eukaryote cells have these 2 organelles)

Between the 1st and 2nd options, none of them is exactly correct. But nucleus and mitochondria are more widely found in various types of cells (plants, etc.)

I would choose the 1st option as the best answer here because it is more detailed.

What are gametes?

male and female reproductive organs
male and female reproductive tissues
male and female reproductive systems
male and female reproductive cells

Answers

Answer:

male and female reproductive cells

Explanation:

I hope it helps ❤❤

Answer:

the last one

Explanation:

Darwin proposed as the process that causes evolution to occur.

Answers

Answer:

natural selection

Explanation:

Darwin proposed natural selection as the process that causes evolution.

According to the theory of natural selection, the environment naturally selects for genes that confer fitness to organisms over every other gene. In other words, organisms that are able to adapt to an environment survive and contribute more to the subsequent generation while those that are poorly adapted contribute less and gradually fade away from the population.

For example, when a drug is taken a particular pathogen, the susceptible ones among the pathogen's population will die off while the ones with the resistance gene survive, reproduce, and pass on the resistance gene to the subsequent generation. Consequently, the same drug might not work at all for the new generations of the pathogen because the gene that confers fitness has been selected for.

Answer:

Natural Selection

Explanation:

Subscribe to Clutch Gam3r on YT

How are herbivore and carnivore alike

Answers

Answer:

They both obtain energy by consuming other organisms.

Explanation:

Hope this helps<3

Answer:they both gather energy from other organisms.

Explanation:

how do you count Karyotypes like how does one come up with 47 or 46?

Answers

Answer:

njjjbbjhhjbvvtuhhvcdfghbhffcvhggfghjhgg

Identify the labeled structures.
A: B: C: D: E:
The multiple questions are the same for each question. Please help!

Answers

Answer:

e cell wall that is the only one I am sure of because I can hardly see the rest

The process by which modern organisms have descended from ancient organisms

Answers

I believe it is called evolution and you can see this with a genetics tree

Answer:

evolution, or change over time

Explanation:

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

PLEASE HELP ME - In 1839, Schleiden and Schwann began formulating a theory of cells and their role in living organisms. Over time, cell theory has been updated. Modern theory is summarized below. All known living things are made up of cells. The cell is the structural and functional unit of all living things. All cells come from pre-existing cells by division. The flow of energy occurs within cells. Cell theory explains all of the following except a. the growth of animals. b. how viruses require the cells of living organisms to survive. c. how bacteria reproduce. d. the storage of chemical energy in plant cells.​

Answers

It made it possible to actually see cells. Explanation: With the development and improvement of the light microscope, the theory created by Sir Robert Hooke that organisms would be made of cells was confirmed as scientist were able to actually see cells in tissues placed under the microscope.

Thank You so Much

your amazing have a great life

how do photosynthesis and cellular respiration affect the CO2 and O2 in our atmosphere?

Answers

Cellular respiration and photosynthesis are important parts of the carbon cycle. The carbon cycle is the pathways through which carbon is recycled in the biosphere. While cellular respiration releases carbon dioxide into the environment, photosynthesis pulls carbon dioxide out of the atmosphere.

(PLEASE HELP I WILL MARK BRAINLEST) Limestone is a sedimentary rock and marble is a metamorphic rock. Despite limestone and marble having the same chemical makeup, which statement describes why they are classified as different rocks?

They formed at different times.

They were formed from different fossils.

They were formed by different methods.

They formed in different amounts of time.

Answers

Answer:

The were formed by different methods

They were formed by different methods is the statement that describes that limestone and marble are classified as different rocks.Therefore, the correct option is C.

What is limestone?

Limestone is a sedimentary rock primarily made up of calcium carbonate (CaCO3) in the form of the mineral calcite. It is formed from the accumulation of shells, coral, and other debris from marine organisms.

Marble is a metamorphic rock that forms from limestone, which is a sedimentary rock composed primarily of calcium carbonate (CaCO3). It is formed through a process of metamorphism, which involves the transformation of the original rock through heat and pressure over time. Therefore, the correct option is C.

Learn more about limestone, here:

https://brainly.com/question/11726100

#SPJ3

The question is incomplete, but most probably the complete question is,

Limestone is a sedimentary rock and marble is a metamorphic rock. Despite limestone and marble having the same chemical makeup, which statement describes why they are classified as different rocks?

A. They formed at different times.

B. They were formed from different fossils.

C. They were formed by different methods.

D. They formed in different amounts of time.

Which best describes the progress of science

Answers

Answer:

Scientific ideas are changed when better ones are found.

Explanation:

The instructions for the traits of an organism are determined by:

the proportions of A, T, C, and G in DNA molecules
the order of nucleotides in DNA molecules
the length of DNA molecules
the way nucleotides are paired in the two strands of a DNA molecule

Answers

Answer:

In all organisms, the instructions for specifying the characteristics of the organism are carried in DNA, a large polymer formed from subunits of four kinds (A, G, C, and T). ...

Most of the cells in a human contain two copies of each of 22 different chromosomes. ...

Changes in DNA (mutations) occur spontaneously at low rates.

The DNA sequences below show DNA segments for four different species. DNA SEQUENCES Species A TGG CAA CGG CAG ATT TAG Species B TGG CTA CGG CAG ATT TAG Species C TGC CTA CGG CTG ATT TAG Species D TGG CTA CTG CTG ATT TAG Scientists sometimes use DNA sequences such as these to determine the relatedness of different species. Which of the following is a necessary condition for scientists to use DNA sequences in this way?

Answers

Answer: I think it's A: the DNA of all organisms contains the same four bases.

Answer:

It’s C

Explanation:

I took the test

What events must have occurred for fossils of marne organisms to be in a mountain far above sea level?​

Answers

Answer:

el sapo

Explanation:

To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disagreement

Answers

Answer:

paper bags jute bags , cotton bags might be used for the environment

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

Drag each image to indicate whether it shows point source pollution or non-point source pollution

Answers

Answer: The first and the last are point source and the second and third are non-point source.

Explanation: I got these right on the quiz.

The first image and the last image are point source pollution while the second and third images represent non point source pollution.

A point source pollution refers to a pollution that is emerging from a particular point such as from a pipe. It is traceable to a given source. The non - point source pollution is not traceable to any particular source.

In the image as shown, the first image and the last image are point source pollution while the second and third images represent non point source pollution.

Learn more: https://brainly.com/question/8592296

What are the locations and end products for the processes of transcription and
translation?

Answers

Transcription is the synthesis of RNA from DNA. Occurs in the nucleus. Translation is the synthesis of a protein from RNA. Occurs in the cytoplasm.

The cytoplasm is the site of translation, the next process that converts a gene into a protein. In order to “read” the sequence of mRNA nucleotides, the ribosome, a specialized complex, interacts with the messenger RNA.

What is role of gene expression in an organism?

It serves as both a volume control that raises or lowers the level of proteins produced, and an on/off switch to regulate when proteins are created.

Because a particular protein can only be made when its gene is turned on, gene expression is significant.

But the process of turning a gene into a protein involves numerous steps, and one of these phases—the production of proteins—is essential for the gene expression pathway that can be altered in cancer.

Therefore, transcription occur at nucleus and translation take place in cytoplasm.

Learn more about gene expression here:

https://brainly.com/question/14182257

#SPJ6

Dissolving CO2 in the ocean is an example of which sphere movement?

Answers

i believe it’s the lithosphere

Which would be an autotroph in a grassland ecosystem?
A. monarch butterfly
B. prairie cordgrass
C. mallard duck
D. muskrat

Answers

Answer:

B. Prairie Cordgrass

Explanation:

100% on the quick check

Autotroph organisms are capable of producing organic compounds from inorganic sources, such as light. All plants are autotroph organisms. The correct option is B. prairie cordgrass.

Let us review the differences between autotroph and heterotroph organisms.

What is an autotroph organism?

Organisms that can take inorganic substances, such as light, and turn it into food according to their own needs are producers, and they are called autotrophic organisms.

These organisms are by excellence all plants, that photosynthesize.

Autotrophs aborb 1% of the energy that reaches the earth's surface. This small percentage of energy flows through all organisms in the ecosystem -from autotrophs to heterotrophs- until it dissipates in the environment.

What is an heterotrophic organism?

Organisms that are incapable of producing their food are called heterotrophic.

They depend on other organisms from the trophic chain such as plants or other animals to feed on, so they can get proteins and energy.

In the trophic chain, heterotrophic organisms occupy different levels after producers.

The prairie cordgrass is the heterotrophic organism.

You can learn more about autotroph organisms at

https://brainly.com/question/1234406

https://brainly.com/question/3490882

How many chlorine atoms are there in the molecule NiCl2

Answers

Answer:

2, that’s what the 2 means.

Explanation:

How do cells support the evolution theory?

Answers

Answer:

Hope this helps!

Explanation:

The endosymbiotic theory explains how eukaryotic cells evolved. The large and small cells formed a symbiotic relationship in which both cells benefited. Some of the small cells were able to break down the large cell’s wastes for energy. They supplied energy not only to themselves but also to the large cell.

4. The fusion sequence in our Sun starts with two
slamming together.
O neutrons
O protons
O electrons
O neutrinos

Answers

neutrons because it’s the only one that would make sense

Answer:

Coc.k

Explanation:

Coc.k

Other Questions
I need help ASAP please HElp Which policy did most Americans favor after World War I? What is the main idea of Ellis island poem I need help with question b What do we mean when we say that the resulting ADP molecule is recycled? a Zoo ticket cost $13 for adults in about $8 for students if a company of 125 people wanted to take his employees to the zoo how much would they have to pay HELP I NEED HELP ASAP how many string object are in 128,55 in python Evaluate the function:f(x)=4x1, find f(9) Which of the following statements is considered a neutral argument? A parallelogram with vertices H(-2, 2),J(5,2), K(-3, 3), and L(-4, -3) is dilatedto form a parallelogram with vertices.H'(-5,5), J'(12.5, 5), K'(-7.5, 7.5), andL'(-10, 7.5). Which representation bestexplains the effect of this dilation?A. (x,y) -> (3x, 3y)OriginalB. (x,y) -> (2.5x, 2.5y)C. (x,y) -> (2x, 2y)D. (x,y) -> (1.5x, 1.5y) Hannah has a chicken coop with 6 hens. Let X represent the total number of eggs the hens lay on a randomly chosen day. The distribution for X is given in the table.A 2-column table with 7 rows. Column 1 is labeled number of eggs with entries 0, 1, 2, 3, 4, 5, 6. Column 2 is labeled probability with entries 0.02, 0.03, 0.07, 0.12, 0.30, 0.28, 0.18.What is the median of the distribution?33.544.2 Why does Rachel say, only it's too late after describing her birthday party? Many sports rely on a similar combination of skills and fitness components. Which skills and fitness components are helpful when playing basketball, soccer, and floor hockey? agility, balance, and muscle strength B agility, flexibility, and muscle endurance C speed, agility, and cardiorespiratory endurance D speed, muscle endurance, and muscle strength 2021 Illuminate Education Inc. I need the answer for these questions plz -1. Choose a quote from the text that supports the following statement, and record it on the lines below. Alvin Ailey used his background to influence the way he danced -2. What is the main idea of Alvin Ailey? Write it in your own words.-3. What can you infer about Alvin Ailey based on his decision to include people from all different backgrounds in his dance company?-4. Describe what the author means when the text says, Alvin prided himself on hiring dancers based on their talent, and not the color of their skin.-5. How has Alvin Aileys work continued today after his death-6. When Alvin Ailey noticed that the dance world was strange and lacked freedom, what did he decide to do?- 7. What are some examples of Alvin Aileys kindness and compassion? Include two pieces of evidence from the passage. A)B) I NEED HELP PLEASE The Manhattan Project resulted in which of the following: A) The destruction of Nagasaki and Hiroshima B) The development of the atomic bomb C) Japan's surrender D) All of the above plz answer my question compared to other countries in the world, china has the... 2. Find the distance between the two points on the coordinate plane given below. I need help and NOW PLEASE