Decide whether the given expression is a polynomial and tell why or why not.





5. 3x2 – 5x + 2

Answers

Answer 1

Answer:

3x² – 5x + 2 is a polynomial because:

Exponents are whole numbers, and the expression has at least 1 term.

Exponents other than whole numbers can take the form of variables in denominators, and roots which we don't want.


Related Questions

Coronary bypass surgery: A healthcare research agency reported that
41% of people who had coronary bypass surgery in 2008
were over the age of 65. Twelve coronary bypass patients are sampled.
Part 1 of 2
(a) What is the mean number of people over the age of 65 in a sample of 12
coronary bypass patients? Round the answer to two decimal places.
The mean number of people over the age of 65 is ?
Part 2 of 2
(b) What is the standard deviation of the number of people over the age of 65
in a sample of 12 coronary bypass patients? Round the answer to four decimal places.
The standard deviation of the number of people over the age of 65 is ?

Answers

The standard deviation of the number of people over the age of 65 in a sample of 12 coronary bypass patients is 1.6487.

Given that a healthcare research agency reported that 41% of people who had coronary bypass surgery in 2008 were over the age of 65 and twelve coronary bypass patients are sampled.

To determine the mean number of people over the age of 65 in a sample of 12 coronary bypass patients, we use the formula below:

Mean = np

Where n = 12 and p = 0.41.

Mean = 12(0.41)

Mean = 4.92

Therefore, the mean number of people over the age of 65 in a sample of 12 coronary bypass patients is 4.92.

To determine the standard deviation of the number of people over the age of 65 in a sample of 12 coronary bypass patients, we use the formula below:

Standard deviation, σ = √(n p q)

Where n = 12, p = 0.41, and q = 1 - p.

Standard deviation, σ = √(12 × 0.41 × 0.59)

Standard deviation, σ = √2.71948

Standard deviation, σ = 1.6487 (rounded to four decimal places).

Therefore, the standard deviation of the number of people over the age of 65 in a sample of 12 coronary bypass patients is 1.6487.

Learn more about standard deviation here:

https://brainly.com/question/29115611

#SPJ11

What is the y-intercept for the equation y= 11x + 1?
-11
-1
1
11

Answers

Answer:

1

Step-by-step explanation:

The y-intercept in the equation is 1 because the equation uses the format y=mx+b. The b in y=mx+b represents the y-intercept So, in this equation the y-intercept is 1 because b=1.

The y intercept is 1. Use the form “y = mx + b”, m is the slope, and b is the is the y intercept. So, you take y = 11x + 1, and b=1.

a cylinder has a volume of 500cm³ and a diameter of 18cm. which of the following is the closest to the height of the cylinder​

Answers

Step-by-step explanation:

Volume of Cylinder =

[tex]500 {cm}^{3} = \pi {r}^{2} h[/tex]

given d = 18

r = 1/2 x d = 9cm,

[tex]\pi( {9}^{2} )h = 500 \\ 81\pi \: h = 500 \\ h = \frac{500}{81\pi} cm[/tex]

I will leave the answer in terms of Pi as I am not sure how you want to leave your answer as.

I NEED HELP WITH MATH PLS
screenshot is posted below

Answers

Answer: The correct answer is A or B

`

Step-by-step explanation:

what are some good editing apps i use alight motion and capcut

Answers

:))))))

Step-by-step explanation:

videochamp, picsart

Picsart , Inshot , Gandr , Photo lab and Viva video.

Park trails and their elevation:
Sand trail has a -2 feet elevation
Cactus Trail has 15 feet elevation
Southern Trail has a -12 feet elevation
Rocky Trail has 42 feet elevation

Chi hiked the Rocky Trail What is the opposite of the elevation of the Rocky Trail?

Answers

Answer:

fjekwnkewgnelwnlgnendndj

Step-by-step explanation:

Plz help me out thanks

Answers

Answer:

the full answer is 215.859885inches cubed

Step-by-step explanation:

times the length, width and height together

The values of certain types of collectibles can often fluctuate greatly over time. Suppose that the value of a limited-edition flamingos riding alligators lawn ornament set is found to be able to be modeled by the function V(t) = 0.06t4 – 1.05t3 + 3.47t? – 8.896 +269.95 for Osts 15 where V(t) is in dollars, t is the number of years after the lawn ornament set was released, and t = 0 corresponds to the year 2006. a) What was the value of the lawn ornament set in the year 2009? b) What is the value of the lawn ornament set in the year 2021? c) What was the instantaneous rate of change of the value of the lawn ornament set in the year 2013? d) What is the instantaneous rate of change of the value of the lawn ornament set in the year 2021? e) Use your answers from parts a-d to ESTIMATE the value of the lawn ornament set in 2022.

Answers

The value of the lawn ornament set in the year 2009 was $51.375. The value of the lawn ornament set in the year 2021 was $558.181. The instantaneous rate of change of the value of the lawn ornament set in the year 2013 was $230.986. The instantaneous rate of change of the value of the lawn ornament set in the year 2021 was $351.076.  The estimated value of the lawn ornament set in 2022 was $909.257.

a)

To find the value of the lawn ornament set in the year 2009, we have to plug in t = 3, as t = 0 corresponds to the year 2006.

V(3) = 0.06(3)4 – 1.05(3)3 + 3.47(3) – 8.896 + 269.95

V(3) = 51.375

So, the value of the lawn ornament set in the year 2009 was $51.375.

b)

To find the value of the lawn ornament set in the year 2021, we have to plug in t = 15, as t = 0 corresponds to the year 2006.

V(15) = 0.06(15)4 – 1.05(15)3 + 3.47(15) – 8.896 + 269.95

V(15) = $558.181

So, the value of the lawn ornament set in the year 2021 is $558.181.

c)

To find the instantaneous rate of change of the value of the lawn ornament set in the year 2013, we have to find V'(7), where V(t) is the given function.

V(t) = 0.06t4 – 1.05t3 + 3.47t – 8.896 +269.95 for Osts 15

V'(t) = 0.24t3 – 3.15t2 + 10.41t + 269.95

V'(7) = 0.24(7)3 – 3.15(7)2 + 10.41(7) + 269.95

V'(7) = $230.986

So, the instantaneous rate of change of the value of the lawn ornament set in the year 2013 was $230.986.

d) To find the instantaneous rate of change of the value of the lawn ornament set in the year 2021, we have to find V'(15), where V(t) is the given function.

V(t) = 0.06t4 – 1.05t3 + 3.47t – 8.896 +269.95 for Osts

15V'(t) = 0.24t3 – 3.15t2 + 10.41t + 269.95

V'(15) = 0.24(15)3 – 3.15(15)2 + 10.41(15) + 269.95

V'(15) = $351.076

So, the instantaneous rate of change of the value of the lawn ornament set in the year 2021 is $351.076.

e)

To ESTIMATE the value of the lawn ornament set in 2022, we can use the formula

V(t) ≈ V(a) + V'(a)(t – a),

where a is the year 2021.

V(a) = V(15) = $558.181

V'(a) = V'(15) = $351.076t = 16 (as we need to estimate the value of the lawn ornament set in 2022)

V(t) ≈ V(a) + V'(a)(t – a)

V(t) ≈ 558.181 + 351.076(16 – 15)

V(t) ≈ $909.257

So, the estimated value of the lawn ornament set in 2022 is $909.257.

To learn more about lawn: https://brainly.com/question/30132672

#SPJ11

PLEASE PLEASE PLEASE HELP 7 points

Answers

Answer:

a) 2x+(x+36)=90

Step-by-step explanation:

b) A1+A2=90°. (A=angle)

2x+(x+36)=90

2x+x+36=90

3x+36=90

3x=90-36

x=54/3

x=18

then A1=2x=2*18=36°

A2=x+36=18+36=54°

Find the absolute value of the number for point E.

Answers

Answer:

1

Step-by-step explanation:

Answer:

The answer is 1

Step-by-step explanation:

E is -1 and the absolute value is the posotive of any number. The positive of -1 is 1.

Use the data set and line plot below. Jerome studied the feather lengths of some adult fox sparrows.
How long are the longest feathers in the data set?

A.
2
2
inches

B.
2
1
4
214
inches

C.
2
1
2
212
inches

D.
2
3
4
234
inches

Answers

Answer: 2 1/2

Step-by-step explanation:

the answer is D i took the test here is proof

Trigonometry question help,,, NO LINKS

Answers

Answer:

87 ft

Step-by-step explanation:

SohCahToa is your best friend here.

You have two values you need to pay attention to:

The length that is adjacent to the 74°C, 25 ft. And the length opposite of the 74°C, the height of how high the rocket traveled.

So adjacent and opposite, O & A. "Toa", find the tangent of 74°C.

tan(74) = [tex]\frac{x}{25}[/tex]

x = (tan(74))(25)

x = 87 ft

Can someone help me ill give you 25 points!!! no wrong answers or ill have brainly take all your points and band you forever Uhm yeah so......... plz help

Answers

Answer: Mean = 2.36 Median = 4 Range = 0

Step-by-step explanation:

Mean - the sum of the data values divided by the number of data values

Median - the middle number in an ordered set of data

Range - the difference between the greatest and least numbers in a data set

It’s tough with a number line

"


A Bernoulli differential equation is one of the form dy + P(x)y dx Q(x)y"" (*) Observe that, if n = 0 or 1, the Bernoulli equation is linear. For other values of n, the substitution u = yl-n

Answers

For values of n other than 0 or 1 in a Bernoulli differential equation, the substitution [tex]u = y^{(1-n)[/tex] is used to transform it into a linear equation.

A Bernoulli differential equation is given by the form:

dy + P(x)y dx = Q(x)[tex]y^n[/tex] (*)

If we consider the case when n = 0 or n = 1, the Bernoulli equation becomes linear. Let's examine each case:

When n = 0:

Substituting[tex]u = y^{(-n) }= y^{(-0)} = 1[/tex], the differential equation becomes:

[tex]dy + P(x)y dx = Q(x)y^0[/tex]

dy + P(x)y dx = Q(x)

This is a linear differential equation of the first order.

When n = 1:

Substituting [tex]u = y^{(-n) }= y^{(-1)},[/tex] we have:

[tex]u = y^{(-1)[/tex]

Taking the derivative of both sides with respect to x:

[tex]du/dx = -y^{(-2)} \times dy/dx[/tex]

Rearranging the equation:

[tex]dy/dx = -y^2\times du/dx[/tex]

Now substituting the expression for dy/dx in the original Bernoulli equation:

[tex]dy + P(x)y dx = Q(x)y^1\\-y^2 \times du/dx + P(x)y dx = Q(x)y\\-y \times du + P(x)y^3 dx = Q(x)y[/tex]

This equation is also a linear differential equation of the first order, but with the variable u instead of y.

In summary, when n is equal to 0 or 1, the Bernoulli equation becomes linear. For other values of n, a substitution u = y^(-n) is typically used to transform the Bernoulli equation into a linear differential equation, allowing for easier analysis and solution.

for such more question on differential equation

https://brainly.com/question/25731911

#SPJ8

a museum gift shop sold 215 sets of dinosaurs. there were 9 dinosaurs in each set how many dinosaurs did they sell?

Answers

They sold 1935 (9•215)

PLSSS HELP IMMEDIATELY!!!!! i’ll give brainiest, i’m not giving brainiest if u leave a link tho. (pls check whole picture!!)

Answers

Answer:

(4,2)

Step-by-step explanation:

Answer:

(4, 2)

Step-by-step explanation:

jesse has never used the sliding board at his daycare because he is afraid. His teacher has encouraged him, but he refuses to slide down. one day his mother stands at the bottom And say's Jesse let's go and slides into his mother's arms Laughing The situation is a example of....

A Resiliency
B Adaptability
C Conditioning
D Social referencing

Answers

D is the answer i believe

jesse has never used the sliding board at his daycare because he is afraid. His teacher has encouraged him, but he refuses to slide down. one day his mother stands at the bottom And say's Jesse let's go and slides into his mother's arms Laughing The situation is a example of Social referencing. Option (d) is correct.

What do you mean by Situation?

Situation refers to a group of conditions or a current state of events.

Social reference is the method through which newborns control their behavior toward surrounding items, people, and circumstances by observing the emotive displays of an adult.

For adaptive social functioning to occur, one must recognize and make use of the emotional communication of others. The ability to negotiate complicated and frequently ambiguous settings is known as social referencing in the developmental literature and social appraisal in adult studies.

Therefore, Option (d) is correct. The situation is a example of Social referencing.

Learn more about Situation, here;

https://brainly.com/question/15540434

#SPJ2

A coffee shop recently sold 8 drinks, including 2 Americanos. Considering this data, how many of the next 20 drinks sold would you expect to be Americanos?

Answers

Answer:

5 drinks will be americanos

Step-by-step explanation:

2:8  (2/8)

simplify

1:4  (1/4)

divide 20 by 4

5:20

The number of next 20 drinks which may be Americanos is 5.

What is Probability?

Probability is simply the possibility of getting an event. Or in other words, we are predicting the chance of getting an event.

The value of probability will be always in the range from 0 to 1.

Given that,

Total drinks sold = 8

Number of drinks that is Americanos = 2

Probability of finding Americano = 2/8 = 1/4

If the total number of drinks next is 20,

Number of Americanos expected = Probability of Americanos × Number of drinks

= 1/4 × 20

= 5

Hence the number of Americanos expected is 5.

Learn more about Probability here :

https://brainly.com/question/30881224

#SPJ2

One winter day, the temperature ranged from a high of 40 °F to a low of -5 °F. By how many degrees did the temperature change?

O 55
O 25
O 45
O 35​

Answers

Answer:

45

Step-by-step explanation:

the correct choice is C.

Apply the properties of exponents to determine which of these numerical expressions
are equivalent to 5^12. Select all that apply.

Very confused and forgot the rules to figuring this out.

Answers

Answer:

Second One-

[tex] {5}^{14}. {5}^{ - 2} [/tex]

Fifth One-

[tex] {5}^{6} \: . \: {5}^{6} [/tex]

Sixth One-

[tex] \sqrt{ {5}^{24} } [/tex]

Seventh One-

[tex] {5}^{11} \: . \: 5 [/tex]

Let R be a commutative ring with 1. An element x ER is nilpotent if x=0 for some n E N. (a) Prove that the set N(R) := {x ER: x is nilpotent} is an ideal of R. (b) Prove that N(R/N(R)) = 0.

Answers

(a) To prove that the set N(R) = {x ∈ R: x is nilpotent} is an ideal of the commutative ring R with 1.

We need to show that it satisfies the two conditions of being an ideal: closure under addition and closure under multiplication by elements of R.

To demonstrate closure under addition, let x and y be nilpotent elements in N(R). This means that there exist positive integers m and n such that xm = 0 and yn = 0.

We want to show that x + y is also nilpotent. By expanding (x + y)^k using the binomial theorem, we can see that each term involves a product of powers of x and y. Since both x and y are nilpotent, their product is also nilpotent.

Therefore, the sum (x + y) raised to a sufficiently high power will result in zero, showing that x + y is indeed nilpotent. Hence, N(R) is closed under addition.

To prove closure under multiplication by elements of R, let x be a nilpotent element in N(R) and r be any element in R. We aim to show that rx is nilpotent. Since x is nilpotent, there exists a positive integer m such that xm = 0.

When we raise rx to a sufficiently high power, (rx)^k, it can be expanded as r^k * x^k. Since x^k is zero due to x being nilpotent, the product r^k * x^k is also zero. Therefore, rx is nilpotent, and N(R) is closed under multiplication by elements of R.

Hence, N(R) satisfies both conditions of being an ideal, and thus, it is an ideal of the commutative ring R.

(b) To prove that N(R/N(R)) = 0, we want to show that every element in R/N(R) is not nilpotent.

Let [x] be an element in R/N(R), where [x] represents the equivalence class of x modulo N(R). Our goal is to demonstrate that [x] is not nilpotent, meaning it is not equal to the zero element in R/N(R).

Suppose, for contradiction, that [x] = 0 in R/N(R). This would imply that x belongs to N(R), the set of nilpotent elements in R. However, if x is an element of N(R), it means that x is nilpotent, and by definition, there exists some positive integer n such that xn = 0. This contradicts our assumption that [x] = 0, since it would imply that x is not nilpotent.

Therefore, our assumption that [x] = 0 leads to a contradiction, and we conclude that every element in R/N(R) is not nilpotent.

Consequently, N(R/N(R)) = 0, indicating that the set of nilpotent elements in the quotient ring R/N(R) is empty.

In summary, we have shown that N(R/N(R)) = 0 and established that N(R) is an ideal of the commutative ring R.

To know more about commutative refer here:

https://brainly.com/question/32556076#

#SPJ11

The solution to a logistic differential equation corresponding to a specific hyena population on a reserve in A western Tunisia is given by P(t)= The initial hyena population 1+ke-0.57 was 40 and the carrying capacity for the hyena population is 200. What is the value of the constant k? (A) 4 (B) 8 (C) 10 (D) 20 6. Which of the following differential equations could model the logistic growth in the graph? AM 50 40 30/ 20 10 t (A) (B) dM =(M-20)(M-50) dt dM = (20-MM-50) dt dM = 35M dt dM = 35M(1000-M) dt (C) (D)

Answers

The logistic differential equation for the hyena population is given by:

dP/dt = r * P * (1 - P/K)

where P(t) is the hyena population at time t, r is the growth rate, and K is the carrying capacity.

We are given that:

P(t) = 40 + k * e^(-0.57t)

K = 200

To determine the value of k, we can plug in these values into the logistic differential equation and solve for k:

dP/dt = r * P * (1 - P/K)

dP/dt = r * P * (1 - P/200)

dP/dt = r/200 * (200P - P^2)

dP/(200P - P^2) = r dt

Integrating both sides, we get:

-1/200 ln|200P - P^2| = rt + C

where C is a constant of integration.

Using the initial condition P(0) = 40 + k, we can solve for C:

-1/200 ln|200(40+k)-(40+k)^2| = 0 + C

C = -1/200 ln|8000-480k|

Plugging in this value of C and simplifying, we get:

-1/200 ln|200P - P^2| = rt - 1/200 ln|8000-480k|

ln|200P - P^2| = -200rt + ln|8000-480k|

|200P - P^2| = e^(-200rt) * |8000-480k|

200P - P^2 = ± e^(-200rt) * (8000-480k)

Since the population is increasing, we choose the positive sign:

200P - P^2 = e^(-200rt) * (8000-480k)

Using the initial condition P(0) = 40 + k, we get:

200(40+k) - (40+k)^2 = (8000-480k)

8000 + 160k - 2400 - 80k - k^2 = 8000 - 480k

k^2 + 560k - 2400 = 0

(k + 60)(k - 40) = 0

Thus, k = -60 or k = 40. Since k represents a growth rate, it should be positive, so we choose k = 40. Therefore, the value of the constant k is option (A) 4.

For the second part of the question, the logistic equation that could model the growth in the graph is option (B) dM/dt = (20-M)*(M-50). This is because the carrying capacity is between 20 and 50, and the population growth rate is zero at both of these values (i.e. the population does not increase or decrease when it is at the carrying capacity).

Learn more about  equation from

https://brainly.com/question/17145398

#SPJ11

Consider Z is the subset of R with its usual topology. Find the subspace topology for Z.[r2]

Answers

The subspace topology for Z, which is a subset of R with its usual (standard) topology, is the set of open sets in Z.

In other words, the subspace topology on Z is obtained by considering the intersection of Z with open sets in R.

To find the subspace topology for Z, we need to determine which subsets of Z are open. In the usual topology on R, an open set is a set that can be represented as a union of open intervals. Since Z is a subset of R, its open sets will be the intersection of Z with open intervals in R.

For example, let's consider the open interval (a, b) in R. The intersection of (a, b) with Z will be the set of integers between a and b (inclusive) that belong to Z. This intersection is an open set in Z.

By considering all possible open intervals in R and their intersections with Z, we can generate the collection of open sets that form the subspace topology for Z. This collection of open sets will satisfy the axioms of a topology, including the properties of openness, closure under unions, and closure under finite intersections.

To know more about subspace, refer here:

https://brainly.com/question/32552995#

#SPJ11

Concession stand sales for each game in season are $320, $540, $230, $450, $280, and $580. What is the mean sales per game? Explain how you got your answer.

Answers

Answer:

$400

Step-by-step explanation:

all you do is add 320+540+230+450+280+580/6 and the asnwe comes out to 400

John buys 6 shirts. For every shirt you purchase, you get one for 30% off. If the normal
price for each shirt is $20.00, how much money did John spend on his shopping trip? (Tax is not being calculated.)

Answers

Answer:

$36

Step-by-step explanation:

Basically, every shirt is $6 because 30% of 20 is 6. If he buys 6 shirts, then 6 times 6 is 36 dollars spent, tax not included.

.
Four different cellular phone plans are shown below.
• Plan 1 charges $0.35 per minute with no monthly fee.
Plan 2 charges a monthly fee of $10.00 plus $0.25 per minute.
• Plan 3 charges a monthly fee of $59.95 with 200 free minutes.
Plan 4 charges a monthly fee of $15.00 plus $0.20 per minute.
Which plan is the least expensive for 200 minutes of cellular phone use?
.
A. Plan 4
B. Plan 3
C. Plan 1
O
D. Plan 2

Answers

A paln1 charges $0.35 per minute with no monthly fee (not sure )

In a normal distribution, 95% of the data falls within 1 standard deviation of
the mean.

True or False?

Answers

Answer:

False

Step-by-step explanation:

A P E X

Compute the pooled variance given the following data:

N_1 = 18, n_2 = 14, s_1 = 7, s_2 = 8

Round to two decimal places

Answers

By computing the pooled variance given the following data N_1 = 18, n_2 = 14, s_1 = 7, s_2 = 8, the pooled variance is 436.40.

To compute the pooled variance given N_1 = 18, n_2 = 14, s_1 = 7, s_2 = 8, we can use the formula below;

S_p² = [(n₁ - 1)S₁² + (n₂ - 1)S₂²] / (N - 2),

where S_p² = pooled variance, n₁ = sample size of first group, n₂ = sample size of second group, S₁² = variance of first group, S₂² = variance of second group, and N = total sample size.

To plug in the values, we have: N₁ = 18n₂ = 14S₁ = 7S₂ = 8

Substituting the values into the formula above we get;

S_p² = [(18 - 1)(7²) + (14 - 1)(8²)] / (18 + 14 - 2)S_p² = (17 × 49 + 13 × 64) / 30S_p² = 436.4

Round off to two decimal places to get 436.40.

You can learn more about variance at: brainly.com/question/31432390

#SPJ11

Suppose that X₁, X₂,..., X₂ form a random sample from an exponential distribution with an unknown parameter 3. (a) Find the M.L.E. 3 of 3. (b) Let m be the median of the exponential distribution, that is, 1 P(X₁ ≤m) = P(X₁ ≥ m) = 2 Find the M.L.E. m of m. ‹8 ||

Answers

(a) MLE of $\lambda$ is obtained by maximizing the log-likelihood. Suppose that X1,X2,…,XnX1,X2,…,Xn are independent and identically distributed exponential random variables with parameter λ, then the probability density function of XiXi is given by $$f(x_i;\lambda) =\lambda e^ {-\lambda x_i}, \quad x_i\geq0. $$

The log-likelihood function is given by$$\begin{aligned}\ln L(\lambda) &= \ln (\lambda^n e^{-\lambda(x_1+x_2+\cdots+x_n)}) \\&=n\ln \lambda-\lambda(x_1+x_2+\cdots+x_n).\end{aligned}$$

The first derivative of the log-likelihood function with respect to λλ is$$\frac {d\ln L(\lambda)} {d\lambda} = \frac{n}{\lambda}-x_1-x_2-\cdots-x_n.$$

The first derivative is zero when $$\frac{n}{\lambda}-\sum_{i=1} ^{n} x_i=0. $$Hence, the MLE of λλ is $$\hat{\lambda} =\frac{n}{\sum_{i=1} ^{n} x_i}. $$

Substituting the value of $\hat{\lambda} $ gives the maximum value of the log-likelihood. So, the MLE of $\lambda$ is given by $$\boxed{\hat{\lambda} =\frac{n}{\sum_{i=1} ^{n} x_i}}. $$

The MLE of $\lambda$ is $\frac {3} {\sum_{i=1} ^{n} x_i}$.

(b) The median of the exponential distribution is given by$$m = \frac {\ln (2)} {\lambda}. $$

Therefore, the log-likelihood function for median is given by$$\begin{aligned}\ln L(m) &= \sum_{i=1}^{n} \ln f(x_i;\lambda)\\&= \sum_{i=1}^{n} \ln \left(\frac{1}{\lambda}e^{-x_i/\lambda}\right)\\&= -n\ln\lambda-\frac{1}{\lambda}\sum_{i=1}^{n}x_i.\end{aligned}$$

The first derivative of the log-likelihood function with respect to mm is$$\frac {d\ln L(m)} {dm} = \frac {1} {\lambda}-\frac {1} {\lambda^2} \sum_{i=1} ^{n}x_i\ln 2. $$

The first derivative is zero when $$\frac {1} {\lambda} =\frac{1}{\lambda^2}\sum_{i=1}^{n}x_i\ln 2.$$Hence, the MLE of mm is $$\boxed{\hat{m} = \frac{\ln 2}{\bar{x}}}.$$where $\bar{x}=\frac{1}{n}\sum_{i=1}^{n}x_i.$Therefore, the MLE of m is $\frac {\ln 2} {\bar{x}}. $

To know more about probability, refer to:

https://brainly.com/question/29660226

#SPJ11

In real-life applications, statistics helps us analyze data to extract information about a population. In this module discussion, you will take on the role of Susan, a high school principal. She is planning on having a large movie night for the high school. She has received a lot of feedback on which movie to show and sees differences in movie preferences by gender and also by grade level. She knows if the wrong movie is shown, it could reduce event turnout by 50%. She would like to maximize the number of students who attend and would like to select a PG-rated movie based on the overall student population's movie preferences. Each student is assigned a classroom with other students in their grade. She has a spreadsheet that lists the names of each student, their classroom, and their grade. Susan knows a simple random sample would provide a good representation of the population of students at their high school, but wonders if a different method would be better. a. Describe to Susan how to take a sample of the student population that would not represent the population well. b. Describe to Susan how to take a sample of the student population that would represent the population well. c. Finally, describe the relationship of a sample to a population and classify your two samples as random, cluster, stratified, or convenience.

Answers

a. To take a sample of the student population that would not represent the population well, Susan could use a biased sampling method.

For example, she could choose students only from specific classrooms or grade levels that she believes have a certain movie preference, or she could select students based on her personal biases or preferences. This would introduce sampling bias and potentially skew the results, leading to a sample that does not accurately reflect the overall student population.

b. To take a sample of the student population that would represent the population well, Susan should use a random sampling method. Random sampling ensures that every student in the population has an equal chance of being selected for the sample.

c. A sample is a subset of the population that is selected for analysis to make inferences about the entire population. The relationship between a sample and a population is that the sample is used to draw conclusions or make predictions about the population as a whole.

To know more about Random samples:- https://brainly.com/question/30759604

#SPJ11

Other Questions
Bill Clinton reportedly was paid $15.0 million to write his book My Life. The book took three years to write. In the time he spent writing, Clinton could have been paid to make speeches. Given his popularity, assume that he could earn $8.4 million per year (paid at the end of the year) speaking instead of writing. Assume his cost of capital is 10.2% per year. a. What is the NPV of agreeing to write the book (ignoring any royalty payments)? b. Assume that, once the book is finished, it is expected to generate royalties of $4.7 million in the first year (paid at the end of the year) and these royalties are expected to decrease at a rate of 30% per year in perpetuity. What is the NPV of the book with the royalty payments? A semi-commercial test plant produced the following daily outputs in tonnes/ day: 1.3 2.5 1.8 1.4 3.2 1.9 1.3 2.8 1.1 1.7 1.4 3.0 1.6 1.2 2.3 2.9 1.1 1.7 2.0 1.4 a) Prepare a stem-and leaf display for these data. b) Prepare a box plot for these data. Fill the blanks in the following statements with suitable words or phrases. In the global economy, the export of a country is the 1. of another. 2 The theory that explains why trade can bring benefits to all participants is based on the advantage. concept of 3. An individual, a region, or a country has a comparative advantage over another individual, region, or country in producing a good or services when it can produce the good or service with lower compare to the other. 4. The important factor why specialization and trade can bring benefits to all participating parties is advantage, not advantage. 5. With the same amount of inputs, if Vietnam can produce more in both rice and telephones than Laos then Vietnam is said to have in both products. 6. If an economy is said to have comparative advantage in producing a good, international the domestic price of the good to the world price, which will better off while making domestic trade will make domestic worse off. 7. When an economy has comparative in producing a good, international trade will redistribute income from domestic to domestic but the gain in surplus is greater than the loss in surplus. 8. When an economy does not have a comparative advantage in producing a good. international trade will the domestic price of the good to the world price, the difference between domestic quantity supplied and domestic quantity demanded will be compensated by 9. When an economy does not have comparative advantage in producing a good, international trade will redistribute income from domestic to domestic and the net social benefit. 10. An imposed tariff will the price and the revenue of the domestic the revenue of the foreign producers. producers as well as 11. than the world When a tariff is imposed, the domestic price will become price. 12. If a tariff is imposed on a good, the domestic quantity demanded for this good will the domestic quantity supplied will the import quantity will 13. Tariff will make domestic and better off but make domestic worse off. 89 14. is the policy that creates a maximal limit to the amount of product that can be imported during a specific period. 15. Using export subsidy means that the tax money of a country is used to support domestic producers who have efficiency in comparison with foreign producers. after the government 16. Net social benefit from international trade will subsidize export activities. 17. product for Voluntary export restraint (VER) acts like a of a country, it usually used to negotiate for other benefits from the importing country. 1 PART 4 - CONCEPT MATCHING QUESTIONS 1) Match each concept to its appropriate definition A Trade surplus F Comparative advantage B Free trade area G Absolute advantage ic Trade deficit Specialization D Import quota Export E Import 1. The amount that import value exceeds the export value. 2. Limitation to the amount that a country could import. 3. The amount that export value exceeds import value. 4. An area with minimal international trade restrictions. 5. Buy a good or service that was produced in another country. 6. The ability of an individual or a country to produce a good with lower opportunity cost than other individuals or countries. 7. When a country concentrated its resources to produce a large amount of a good or services for consumption and trading. 8. Sell a good or service in another country. 9. The ability of an individual or a country to produce more of a good than other individuals or countries using the same amount of inputs. Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future? Suppose consumption is a linear function of disposable income: C(YT) = a + b(Y T), where a > 0 and 0 < b < 1. Suppose also that investment is a linear function of the interest rate: I(r) = c - dr, where c> 0 and d > 0. a. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. b. How does the slope of the IS curve depend on the parameter d, the interest rate sensitivity of investment? Prepare a 5 mins PPT presentations with voice overs to the board members on the financial strength of Cool-Ice especially in financing its long-term loan. find the two x-intercepts of the function f and show that f '(x) = 0 at some point between the two x-intercepts. f(x) = x x 2