Colin gets £x wages each week. After he pays his tax of £t, he
then pays his rent of £120. He shares what's left between
himself and his wife. How much do they each get?

Colin Gets X Wages Each Week. After He Pays His Tax Of T, Hethen Pays His Rent Of 120. He Shares What's

Answers

Answer 1

Answer:

They will each get ;

(x-t)/2 - 60

Step-by-step explanation:

Here, we want to know the amount of money that Colin and his wife gets

we start by subtracting the necessary terms

Mathematically, that would be;

x-t-120

So what each of them get will be;

(x-t-120)/2

= (x-t)/2 - 60


Related Questions

PLS I HAVE JUST 20 MINS HELP

Answers

Answer:

a7 b8

Step-by-step explanation:

per
(in meters)
3.23
3.18
3.22
3.19

Answers

Answer:

Can you please be more specific what do I convert it to.

Step-by-step explanation:

Select the correct answer.
Which function passes through the points (2, 15) and (3, 26)?
A.
y = 11x + 7
B.
y = 11x − 7
C.
y = 7x + 11
D.
y = -11x − 7
E.
y = 7x − 11

Answers

B. y = 11x - 7 passes through the points (2 , 15) and (3 , 26)

Answer:

B. y = 11x - 7 passes through the points (2 , 15) and (3 , 26)

Step-by-step explanation:

You are printing out information packets for your company. You will need a total of 6,400 pages to complete all of the packets. How many reams of 500 pages each will you need in order to print out all of these packets?

Answers

Answer:

13 reams

Step-by-step explanation

Given

Total number of pages to complete the packet = 6400 pages

If each ream contains 500pages, then:

Total number of reams needed = Total pages/number of pages per ream

Total number of reams needed = 6400/500

Total number of reams needed = 12.8

Hence you will need about 13 reams for all the packets

For the following right triangle, find the side length x.

Answers

Answer:

x = 17

Step-by-step explanation:

Since its a right triangle, you can use Pythagorean Theorem.

8² + 15² = x² (Given)

64 + 225 = x² (Simplify)

289 = x² (Add like terms)

17 = x (Square root both sides)

Find the area of this parallelogram.

Answers

Answer:

147.03 cm

Step-by-step explanation:

Answer:

147.03

Step-by-step explanation:

WxL=147.03

I think this is right ❤️

the 4 angles of heptagon equal and each of other 3 is 20° greater the first 4.Find the angles​

Answers

Answer:

interior angle of a heptagon = 900 degrees

900 = 4x + (3x + 60)

840 = 7x

840/7 = 120

X = 120

120 X 4 = 480

120 X 3 = 360

480 + 360 + 60 = 900

4 angles = 120 degrees each

3 angles = 140 degrees each

During their last game, the Miami Dolphins scored ͸ times for a total score of ͵Ͳ points. They scored ͹ points for each touchdown and ͵ points for each field goal. Write and solve the systems of equations to find the total touchdowns and field goals scored.

Answers

Answer:

The Miami Dolphins had 3 touchdowns and 3 field goals.

Step-by-step explanation:

It is given that During their last game, the Miami Dolphins scored 6 times, for a total score of 30 points. They scored 7 points for each touchdown and 3 points for each field goal.

We need to write and solve the system of equations to find the total touchdowns and field goals scored.

Let x represents the number of touchdowns.

Let y be the number of field goals.

It is given that the Miami Dolphins scored 6 times

[tex]x+y=6[/tex]

[tex]x=6-y[/tex]....(1)

They scored 7 points for each touchdown and 3 points for each field goal.

The total score is 30 points:

[tex]7x+3y=30[/tex] ...(2)

Put the value of x from equation (1) into equation (2).

[tex]7( 6-y)+3y=30[/tex]

[tex]42-7y+3y=30[/tex]

[tex]-4y=30-42[/tex]

[tex]-4y=-12[/tex]

[tex]y=3[/tex]

Put y = 3 in equation 1.

[tex]x=6-3[/tex]

[tex]x=3[/tex]

Hence, the Miami Dolphins had 3 touchdowns and 3 field goals.

Find the value of y....?

Answers

Answer:

B) 12

Step-by-step explanation:

(9y + 7)° + (7y - 19)° = 180° (interior angles in the same side of transversal)

(9y + 7 + 7y - 19)° = 180°

(16y - 12)° = 180°

16y - 12 = 180

16y = 180 + 12

16y = 192

y = 192/16

y = 12

Answer:

9y+7=7y-19

7+19=7y-9y

26=-2y

26/-2=-2y/-2

y=-13

I hope this helps:

5x + 3y = 5
5x + 7y = 25

Answers

Answer:

(-2,5)

Step-by-step explanation:

Ryan drinks 1 1/2 liters of water every 3/4 of an hour at a constant rate.
How many liters of water does he drink in 3 hours?

Answers

22 Liter Ryan drinks 22 liters

Answer:

6

Step-by-step explanation:

Which of these grids is shaded red and blue in the ratio 1:2?

Answers

Total squares= 12

1x + 2x = 12

3x = 12

3x/3 = 12/3

x = 4


1x4 = 4

2x4 = 8

So. C is the answer

The number of red cells are 4 and the number of blue cells are 8. Then the correct option is C.

What are ratio and proportion?

A ratio is a collection of ordered integers a and b represented as a/b, with b never equaling zero. A proportionate expression is one in which two items are equal.

In the grids, there are 12 square box.

Let R be the red and B be the blue.

R + B = 12   ...1

R / B = 1/2  ...2

By solving equation 1 and 2, we have

R + 2R = 12

      3R = 12

        R = 4

Then  

4 + B = 12

     B = 8

Then the correct option is C.

More about the ratio and the proportion link is given below.

https://brainly.com/question/14335762

#SPJ2



A robin can fly 10 miles per hour faster than a blue jay. It takes a robin 1 1/2 hours to fly 45 miles.

How many hours will it take a blue jay to fly that same distance?

Answers

Answer: [tex]2\dfrac14\text{ hours}[/tex]

Step-by-step explanation:

Given:  It takes a robin [tex]1\dfrac12[/tex] hours to fly 45 miles.

[tex]1\dfrac12=\dfrac32[/tex]

Speed of robin= [tex]\dfrac{distance}{time}=\dfrac{45}{\dfrac32}[/tex]

[tex]\dfrac{45}{3}\times2= 15\times2= 30\text{ miles per hour}[/tex]

A robin can fly 10 miles per hour faster than a blue jay. It

Speed of Blue jay = Speed of robin - 10 miles per hour

= 30 miles per hour - 10 miles per hour

= 20 miles per hour

Time taken to cover 45 miles = [tex]\dfrac{45}{20}=\dfrac{9}{4}=2\dfrac14\text{ hours}[/tex]

Hence, it will take [tex]2\dfrac14\text{ hours}[/tex]  by a blue jay to fly that same distance.

Find two consecutive even integers such that the sum of the smaller and 3 times the larger is 330
I am so stuck please any one help

Answers

Answer:

The 2 numbers = 81 and 83

Step-by-step explanation:

As, one number = x

The other, because it's an even number and consecutive = x + 2

So the larger numbef here is x + 2

And they are saying 3 times x + 2 plus x = 330

So let's solve!

3 times x + 2 = 3(x+2) = 3x + 6

So we will add it to x = (3x + 6) +(x) = 4x + 6

So they are saying the sum of them will be 330

So, 4x + 6 = 330

4x = 330 - 6

4x = 324

x = 324/4

x = 81

So x is the first number = 81

And the second is x + 2 = 81 + 2 = 83

So the 2 numbers are 81, 83

Lets check!

3 times the bigger number = 83 x 3 = 249

We will add it to 81 and we will get 330

So, 249 + 81 = 330

So the answer is right

Terry sees this offer refurbished phone 35% off now only £78 how much was the phone before the discounted price

Answers

Answer:

the price before the discounted price is  £120

Step-by-step explanation:

The computation of the price before the discounted price is shown below:

After giving 35% off the price is £78  that means it is 65% value

So we have to determine the 100% value

So,

= £78 × 1 ÷ 0.65

= £120

Hence, the price before the discounted price is  £120

ASAP NOW AND YOULL GET 20 and ILL ANSWER ONE OF URS

Answers

Answer:

10/40=70/x

Step-by-step explanation:

mainly because the line is pointing at a

A jar contains 21 marbles: 8 white, 3 green, and 10 red. Write the described ratio in simplest form.

A. number of white marbles to number of green marbles.

Answers

Answer:

The question you posted was a bit confusing for me, but I'm assuming that you want the simplified ratio of the number of white marbles to the number of green marbles.

The answer would be 8:3.

Step-by-step explanation:

There are 8 white marbles and 3 green marbles, so you get 8:3. And since 8 and 3 are relatively prime, no simplifying is needed.

The answer is 8:3.

What is the measure of

Answers

Answer:

148°!

Step-by-step explanation:

By taking 180° (The degree of a striaght line) and subract by the other angle (32°) you'll get the answer!!

Ms. Reynold's sprinkler system has 5 stations that water all parts of her front and back lawn. Each station runs for an equal amount of time. If it takes 16 minutes for the first 2 stations to water, how long does it take to water all parts of her lawn?

Answers

Answer: 40 minutes

Step-by-step explanation:

It takes 16 minutes for the first 2 stations to water their sections which means that the time taken per station is:

= 16/2

= 8 minutes per station

Ms. Reynolds has 5 stations.

Total time taken will therefore be:

= 8 * 5

= 40 minutes

Which component is missing from the process of photosynthesis?

Carbon Dioxide + ________ + Sunlight → Glucose + Oxygen

Light Energy
Sugar
Plants
Water

Answers

Answer:

Water i hope it is correct

the answer is water .

What is the solution to the equation 2(4-3x)+5(2x-3) = 20-5x9
Ox=-13
O x=
Ox=2
Ox=3
13

Answers

Ox=3is the answer to this question

The solution of the equation 2(4-3x)+5(2x-3) = 20-5x+9 is 3.

What is Equation?

Two or more expressions with an Equal sign is called as Equation.

The given equation is 2(4-3x)+5(2x-3) = 20-5x+9

x is the variable in the equation.

Plus and minus are the operators

Apply distributive property.

8-12x+10x-15=20-5x+9

Take the variable terms on one side and constants on other side

5x-12x+10x=20-8-15+9

3x=6

Divide both sides by 3

x=2

Hence, the solution of the equation 2(4-3x)+5(2x-3) = 20-5x+9 is 3.

To learn more on Equation:

https://brainly.com/question/10413253

#SPJ7

how can i raise my grade

Answers

Answer:

You can try asking for extra credit assignments, and just become a try hard on whatever assignments you have left. There's not much other thing besides asking for extra credit and trying your best on the assignments you have left

Substitution Method
2x+5y=-1
y=3x+10​

Answers

Substitution for both equations is (-3,1)

Simplify. 11 3/4 - 8 1/2 A. 3 1/4 B. 3 1/3 C. 4 1/4

Answers

Answer:

A

Step-by-step explanation:

11 3/4 - 8 1/2 = 3 1/4

7th grade work help please
will give brainliest:)

Answers

Answer: 67.27

Step-by-step explanation:

7.1 x 7.1 for the square = 50.41

7.1 divided by 2 = 3.55

3.55 x 4.75= 16.86

Normally here you would divide by 2, but you don’t need two because there is 2 triangles that are the same

Add the 50.41 and the 16.86 and you have your answer!

Translate this sentence into an algebraic inequality.
3 more than the product of x and 12 is less than 25.
Select one:
a. 12x + 3 < 25
b. 3 > 12x – 25
c. 3 > 12(x - 25)

Answers

Answer:

Option A

Step-by-step explanation:

Lets convert each sentence into algebric inequality.

3 more than product of x & 12 :-

[tex] = > 12x + 3[/tex]

Now , 12x + 3 is less than 25 :-

[tex] = > 12x + 3 < 25[/tex]

find the probability of the compound event.

not spinning a 2 and flipping heads

there are 4 sections on the spinner. ​

Answers

Answer:

67

Step-by-step explanation:

Explanation: you have a 1/2 chance to flip heads on the coin. You have a 3/4 chance to not spin 2 on the spinner. So when you multiply 1/2 by 3/4 probably you get 3/8 :) I hope this answers your question!
Answer: 3/8 chance

(GIVING BRAINLIEST!!!)

Solve one eighth divided by two equals blank by rewriting it as the multiplication equation one eighth times one half equals blank.

A) 16
B) 1/16
C) 1/10
D) 2/16

Answers

Answer:

B) [tex]\displaystyle \frac{1}{16}[/tex]

Step-by-step explanation:

[tex]\displaystyle \frac{1}{16} = \frac{\frac{1}{8}}{2} \\ \\ OR \\ \\ \frac{1}{8} \div 2 = \frac{1}{8} \times \frac{1}{2} = \frac{1}{16}[/tex]

I am joyous to assist you at any time.

Which shows the image of rectangle ABCD after the rotation (x, y) - (-y, x)?

Answers

Answer:

hey lol

Step-by-step explanation:

it's the one on the right btw

Pls tell me what I put under m and +b

Answers

this qeustion cannot be solved! never seen it before andusally there is a number instead of a y

M will be the slope and b will be the intercept
Other Questions
Part i)Which of the following is the best abbreviation for the word Government?a.) GOVMTb.) GVRNTc.) GOVd.) GOV'TPart ii)In 100 words or less, describe what the U.S Government is/does and why it is/isn't so important. Briefly state your beliefs/views and facts about the U.S Government. You may use any and all online resources to answer this question. Include as much detail as possible in your short answer. Which number is irrational? . Complete the quotation:"I am ...with him in this world" From jekyll and Hyde The function of a retail of purchasing cooperative or "co-op" is toCorrect answer A. obtain lower prices for members.Incorrect answer B. work to improve the image and working conditions of members.Incorrect answer C. save income taxes for members.Incorrect answer D. sell the goods or services produced by members. What does it mean to "Psych yourself up?" How does this term affect the meaning of the text Find three ratlos equivalent to the ratio described in the situationThe ratio of cups of water to cups of milk in a recipe is 1 to 4Three equivalent ratlos are 2 to3 to4 to When a cricket ball is thrown vertically upwards, it reaches a maximum height of 15 metres. (a) What was the initial speed of the ball ? (b) How much time is taken by the ball to reach the highest point ? (g=10 ms -2 What caused president roosevelt to sign into law meat Inspection act? who is a better band1:One direction2: 5 seconds of summer 3: BTS4:Little mix5: other Which of the following describes hetereogeneous mixture... 1)A mixture that is easily separated, the components are different sixes and unevenly mixed. 2) A mixture that is very difficult to separate, the contents are evenly mixed and the mixture looks like a substance Light rays from the sun are called: solar energy heat energy chemical energy a circle has a center at (-2,7). if a point on the circle has coordinates (3,-1) then which of the following would be the length of the radius of the circle write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC if you answer some of them ill appreciate it ( you don't have to answer all of them ) What can cause a significant change in someones life Which value is in the domain of f(x)?f(x) = StartLayout Enlarged left-brace 1st row 1st column 2 x + 5, 2nd column negative 6 less-than x less-than-or-equal-to 0 2nd row 1st column negative 2 x + 3, 2nd column 0 less-than x less-than-or-equal to 47645 How is the idea of freedom presented in Martin luther kings speech? Explain what is meant by "majority opinion".Your answers Lieutenant Patrick O'Bannon defeated the Pasha of Tripoli at ___.ItalyWeehawkenEgyptNew OrleansDerna Explain the role that King George III played during the American Revolution.