If 3 quarts of paint are needed for 50 ft of fence, how many quarts are needed for 300 ft of fence?
at

Answers

Answer 1

Answer:

18

Step-by-step explanation:

First, you would do a proportion

[tex]\frac{3}{50}[/tex]=[tex]\frac{x}{300}[/tex]

Then you would cross multiply, getting 50x=900.

After that, you would do 900/50, which is 18.

Answer 2

To paint 300 feet of fence we need 18 quarts of paint.

What is a unitary method?

A unitary method is a mathematical way of obtaining the value of a single unit and then deriving any no. of given units by multiplying it with the single unit.

Given, 3 quarts of paint are needed for 50ft of fence.

∴ To paint 1 foot of fence (3/50) quarts of paint are needed.

∴ To paint 300 feet of fence (3/50)×300 = 18 quarts of paint needed.

learn more about the unitary method here :

https://brainly.com/question/28276953

#SPJ2


Related Questions

I need the steps. Please help me. Thanks!

Answers

Answer:35x^3 + 15x^2 + 42xz + 28x + 18z + 12

Step-by-step explanation:

(7x + 3) (5x^2 + 6z + 4)

7 (5^2 + 6 + 4) +3 (5^2 + 6 + 4)

35^3 +42 + 28 + 15^2 + 18 + 12

35^3 + 15x^2 + 42xz + 28x + 18z + 12

The table shows the number of minutes Jalen talks on his mobile phone and the cost of the phone calls. Jalen's Mobile Phone Cost Number of minutes, X 150 220 250 275 x Cost, y $7.50 $11.00 $12.50 $13.75 If the cost varies directly with the number of minutes Jalen talks on the phone, which equation represents the variation? O y = 0.05% O y = 20x O y = 157.58 O y = 1125x Save and Exit Net Submit Mark this and return​

Answers

Answer: y=0.5x

Step-by-step explanation: hope this would be helpful ∵∵∵∵∵∵∵∵∴∴∴∴∴∴∴∴∴

You can use the interactive graph below to find the answer.
\begin{cases} y=x+1 \\\\ y=2x-5 \end{cases}









y=x+1
y=2x−5


Choose 1 answer:
Choose 1 answer:

(Choice A)
A
Exactly one solution

(Choice B)
B
No solutions

(Choice C)
C
Infinitely many solutions

Answers

Answer:

there is only one solution.

Step-by-step explanation:

hope this helps!

What is the point slope form for (2,0)(4,6)

Answers

Answer:

0-y=3/4(x-2)

Step-by-step explanation:

Write the explicit rule for the arithmetic sequence
-10, -3, 4, 11,...

Answers

a

0

=

4

a

i

=

a

i

1

+

7

XXXX

possibly with the restriction 1<=i<=4 if this is not intended to be a continuous sequence

Explanation:

This is a simple arithmetic sequence with a difference of  

7

between ascending sequence terms.

Determine the equation of the line passing through the point below having the corresponding
slope.
Point: ( - 25, -9)

Slope: m=1/5

Write your answer as an equation in the form
y = mx + b

Answers

Answer:

y=1/5x-4

Step-by-step explanation:

So, first we're gonna put this into point slope form, (y-y1)=m(x-x1), then we'll convert it. When you plug the numbers in, you get (y+9)=1/5(x+25)

Then, you simplify!

y= 1/5(x+25)-9

y=1/5x+5-9

y=1/5x-4

Hope this helped!

Which points on the wave are the trough and the crest?


Answers

Answer:

ok

trough is the y

Crest is W

I put a picture for help

pleaseee help
A job placement agency helps match job seekers with potential employers. The agency would like to design a simulation in order to help predict the likely job placement outcomes for job seekers based on historical trends and patterns. Which of the following is most likely to be a benefit of the simulation?

A. The computer simulation will be able to include more details and complexity than the real-world job placement process.
B. The computer simulation could be used to test hypotheses about patterns in the job placement process that are costly or time consuming to observe in reality.
C. The computer simulation will be able to precisely predict the real-world outcomes for each job seeker.
D. The computer simulation will remove the bias that may arise in the real-world job placement process.

Answers

Answer:

B.

Step-by-step explanation:

All computer simulations are designed to test a large number of different scenarios with various sets of data in order to understand each output that certain data generates and ultimately find the best solution. This is the overall main reason why simulations are created. The same applies in this scenario, this simulation will be used to test hypotheses about patterns in the job placement process that are costly or time-consuming to observe in reality. If such tests had to be conducted by actual people it would take months, years, or even decades to generate and analyze all the data.

Answer:

Its D

Step-by-step explanation:

You gotta believe me

Find the simple interest on a loan of 23,000 at 5.4% interest for 11 months

Answers

Answer:

Simple interest=1138.5

Step-by-step explanation:

Simple interest=23000×(5.4/100)×(11/12)

S.I=23000×0.054×(11/12)

S.I=1138.5

A pond contains 110 fish, of which 20 are carp. If 10 fish are caught from the lake, what are the mean and variance of the number of carp among those 10?

Answers

Answer:

Mean = 1.82

Variance = 1.365

Step-by-step explanation:

We define X as the random variable that counts the number of the carp fishes that has been caught. Also we assume that all the fishes are equally likely to be caught. In that case we have that X as hypergeometric distribution.

The of the Hypergeometric Distribution and Its variance is given below.

Mean of the distribution = [tex]n*\frac{k}{N}[/tex]

Variance = [tex]\frac{n*k*(N-k)(N-n)}{N^2(N-1)}[/tex]

N= 110

k = 20

n = 10

Upon calculation we get

Mean = [tex]10*\frac{20}{110}[/tex]

          = 1.82

Variance = [tex]\frac{10*20*(110-20)(110-10)}{110*110*(110-1)}[/tex] = 2*90*100/11*11*109 = 1.365

Therefore the mean is 1.82 and variance is 1.365

The mean and the variance of the number of carp are 20/11 and 180/121, respectively

The given parameters are:

Fishes = 110

Carp = 20

The probability of selecting a carp is:

p = 20/110

Simplify

p = 2/11

In a selection of 10 fishes, we have:

n = 10

The mean is:

E(x) = np

This gives

E(x) = 10 * 2/11

E(x) = 20/11

The variance is

Var(x) = E(x) * (1 - p)

So, we have:

Var(x) = 20/11 * (1 - 2/11)

Simplify

Var(x) = 20/11 * 9/11

Evaluate the product

Var(x) = 180/121

Hence, the mean and the variance of the number of carp are 20/11 and 180/121, respectively

Read more about mean and variance at:

https://brainly.com/question/15858152

Find the slope of regular AB, and make sure you reduce the fraction to simpelist form 

Answers

Answer:

The slope is 1/2.

Step-by-step explanation:

evaluate -3 - (-4) - (-2) + 1

Answers

Answer:

4

Step-by-step explanation:

-3 - (-4) - (-2) + 1

-3 + 4+ 2 +1

1 +2+1

2 + 2

4

Solve 2m = 480.6. :)

Answers

Answer:

Step-by-step explanation:

2m=460.6

M=230.3

Domino's offers the following “deals”:
Deal #1: $10 for one large pizza and $5 for each additional large pizza on the same order.
Deal #2: $6.00 per large pizza
What equation can we use to graph a line showing the different pizza deals?

Answers

Answer: Deal one: 5x+10

Deal two: 6x

Which expressions have the same value as the product of 0.06 X 3.9?

Circle the letter for all that apply.
A 216 X 0.001
B 0.216 X 0.01
C 21.6 X 0.01
D 2.16 X 0.1
E 216 X 0.01

Answers

The answer is
B
Good luck hope it’s right

6plus 6 times 1 divide 9

Answers

Answer:

6+6x1/9= 6.66666666667

Thats the long way and i used mental math and quick math to get the answer :)

HAVE A WONDERFUL DAY

-ary

Answer:

6.666...

Step-by-step explanation:

6 + 6 * 1 / 9

6 + 6 / 9

6 + 2/3

6.666....

HELP!!!!!A school is having a competition to see who can read the most books in one month (30 days). In the first 5 days, Jake reads 4 books. Meanwhile, Amy reads 5 books over 6 days. If they continue at these rates, who will win? By how many books?​

Answers

is there a rate because im not understanding

Solve the real-world situation by using the substitution method.

One smartphone plan costs $30 per month for talk and messaging and $8 per gigabyte of data used each month. A second smartphone plan costs $60 per month for talk and messaging and $3 per gigabyte of data used each month. Let c represent the total cost in dollars and d represent the amount of data used in gigabytes. The system of equations lbrace c = 30 + 8d c = 60 + 3d can be used to represent this situation.

How many gigabytes would have to be used for the plans to cost the same? What would that cost be?

Both plans would cost $_____
if _____ gigabytes of data are used.

Answers

Plug in guesses till the answer are equal or the same. I started with 10 and 15 because I could compute that quickly and it was very close so then I saw I needed to bring one side up and one side down for the answers to be the same.
C=30+8d Data usage here would be 9= and the program would cost $102
C=60+3d. Data usage here would be14=and this program would cost $102

I'm not understanding ​

Answers

Answer:

D. x = 3

Step-by-step explanation:

We would like to find out for what value of x does f(x) = g(x). This is essentially the same as asking us to find the x-value for which f(x) = k, where k is some number, and g(x) = k, as well.

Looking at the two tables provided, we notice that when x = 3, both f(x) and g(x) equal -2. So, the answer is D.

Could I get help with this?

Answers

Answer:

x int= -4 y int= 1

Step-by-step explanation:

intercepts refer to the place on the each axis where the line passes through

A ratio of 3 erasers and 6 pencils could be expressed as 3:6. If the number of erasers is represented by white circles and the number of pencils is represented by black circles, which is a correct representation of the ratio?

Answers

Answer:

It'd be C.

There are 3 erasers shown and 6 pencils and to simplify the given ratio it would be 1:2

So the third representation would be the one that made the most sense.

Answer:

Option 3

Step-by-step explanation:

Ratios can be written as fractions, so 3:6=3/6. That can be simplified to 1/2, 1:2. That mesns for every eraser, there are two pencils. If white circles are erasers and black circles pencils, the correct answer will be the answer with one white circle and two black circle in each group. So the correct answer will be the third one.

According to the graph below, what percent of the Simpsons’ annual expenses is Federal taxes? A circle graph titled Simpson's Annual Expenses. Federal taxes, 24 percent; State/local taxes, 10 percent; Housing and household, 23 percent; Food, 6 percent; Medical care, 8 percent; Transportation, 11 percent; Recreation, 3 percent; Clothing, 5 percent; Other, 10 percent. a. 10% b. 14% c. 24% d. 34%

Answers

According to the graph, the percentage of the Simpsons’ annual expenses that is Federal taxes is 24%

What is a circle graph?

A circle graph also known as pie chart has a shape of a circle and each section are represented in percentages or degrees

From the question, we have:

Federal taxes = 24%State/local taxes = 10%Housing and household = 23%;Food = 6%Medical care = 8%Transportation = 11%Recreation = 3%Clothing = 5%Other = 10%

The above means that the percentage of the Simpsons’ annual expenses that is Federal taxes is 24%

Read more about circle graphs at:

https://brainly.com/question/24461724

Answer:

10%

Step-by-step explanation:

Only need a answer for problem a

Answers

The answer is 120. Find the supplementary angles by subtracting 60 from 180.

180-60=120

A linear pair : two angle that make up to 180 degrees

X = 120 degrees

The linear pair is angle B and angle C.

Jimmy scored 49 goals in soccer this season.tommy scarred 7 times fewer goals how many goals did tommy score

Answers

i do not know how to play soccer but if you are only subtracting 7 from 49, the answer would be 42.

so my answer is 42 unless you aren’t supposed to subtract
Your answer is gonna be 42 !

Which of these is the simplest form of x2-2x/x2-4?

Answers

Answer:

The first one

Step-by-step explanation: hope this helps!

The sum of a number, x, and 1/2 is equal to 4. Which set of equations correctly represents x?

Answers

Answer:4=1/2x

X=8

Step-by-step explanation:

hi!! please help :) i hope you guys are having a good day/night!!

Answers

Answer:

x = 13, y = 26

The length of the sides of Δ QRS are QR = 104, QS = 468, RS = 76

Step-by-step explanation:

In ΔRQS

∵ M is the mid-point of side RQ

→ That means M divide RQ into 2 equal parts RM and MQ

RM = MQ

∵ RM = 4x

∵ MQ = 52

→ Equate them

4x = 52

→ Divide both sides by 4 to get x

x = 13

∵ P is the mid-point of side QS

→ That means P divide QS into 2 equal parts QP and PS

QP = PS

∵ QP = 9y

∵ PS = 234

→ Equate them

9y = 234

→ Divide both sides by 9 to get y

y = 26

→ Find the length of each side

∵ RQ = 52 + 52

RQ = 104

∵ QS = 234 + 234

QS = 468

∵ RS = 38 + 38

RS = 76

∴ The length of the sides of Δ QRS are QR = 104, QS = 468, RS = 76

Note: PS = 234 is wrong because it made the length of the sides QS = 468, which could not be because the sum of any 2 sides of a triangle must be greater than the 3rd side. So check it.

What life insurance policy never expires?

Answers

Answer:

whole life insurance

Step-by-step explanation:

Answer:

Term life insurance and Universal life

Step-by-step explanation:

WILL GIVE BRAINLIEST!!
What is the value of 1/60?

Answers

Answer:

1/6

Step-by-step explanation:

Answer:

C. 1

Step-by-step explanation:

Calc I Question help

Answers

The way the question is phrased, it sounds like the height stays fixed at 18 in. If L and W denote the raft's length and width, respectively, then its volume V is given by

V = 18 L W

Differentiating both sides with respect to time t gives

dV/dt = (18 in) W dL/dt + (18 in) L dW/dt

We're told that dL/dt  = -1 in/s and dW/dt = -2 in/s, so that at the moment L = 11 in and W = 4 in, the volume is changing at a rate of

dV/dt = (18 in) (4 in) (-1 in/s) + (18 in) (11 in) (-2 in/s)

dV/dt = -468 in³/s

so the raft is losing air at a rate of 468 in³/s. (Note that "losing" captures the negative sign from before.)

Other Questions
PLZ HELP! DUE TODAY! I WILL GIVE BRAINLIEST TO FIRST ANSWER THAT IS CORRECT!The parts of a personal letter are similar to a business letter but slightly different in form. True False Angle J and angle K are complementary angles. The measure of angle J is 18 less than the measure of angle K. Fine the measure of both angles.Please and thank you. Describe the pattern in the following sequence and list the next three terms:4,8, 16, 32, ... I need help with this ASAP ..... It is over due and I have to get it done and show work .. Please and thank you who is your favorite character from Gorillaz and why?? :) what are Sources of thermal pollution Solo Corp. is evaluating a project with the following cash flows: Year Cash Flow 0 $28100 1 10,300 2 13,000 3 14,900 4 12,000 5 8,500 The company uses an Interest rate of 8 percent on all of Its projects. a. Calculate the MIRR of the project using the discounting approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places. e.g., 32.16.) b. Calculate the MIRR of the project using the reinvestment approach. (Do not round Intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) c. Calculate the MIRR of the project using the combination approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) a. Discounting approach MIRR % b. Reinvestment approach MIRR % c. Combination approach MIRR Y. Find the quotient: 6)27L 600 mL Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT The corect phase sequence shownGas, Liguid, SolidLqud, Gas, SolidSold, Liguid, GasGas, Solid, Liquidabove i Which word comes from the Greek root meaning life A-boulevard B-BiologyC-bombardD-barometer Can Someone help me please Requiring children to be vaccinated before entering school is an example of what power? need help for civics What is the mass of 1.00 mol of oxygen (O2)? Cual Es el mejor programa esta ano A car is 180 inches long. A truck is 75% longer than the car. How long is the truck? How are ionic compounds named? Giving everything. Plzzz help. Which scientific term could be used in place of the word germ?a. bacteriologyb. pathogenc. hostd. replicate Form a correct sentence by unscrambling the following jumbled words:El pueblo el en reino.El en el pueblo reino.El pueblo el reino en.El pueblo en el reino.Pueblo el en reino el.