Based on the chart, a young man who has been a member of a gang for one year has likely committed about criminal offenses.
If a young man stays in a gang for three years, the number of likely criminal offenses to .

Answers

Answer 1

Answer:

On E2020

Have a Great Day :)

Based On The Chart, A Young Man Who Has Been A Member Of A Gang For One Year Has Likely Committed About
Answer 2

Based on the chart, if a young man stays in a gang for three years, the number of likely criminal offenses to 50.

What is a criminal offense?

Criminal offense is the activity which is against the laws of crime bureau. These activities can be robbery, murders, assaults, etc. The person who perform these criminal activities got punishment under law.

Thus, the number of likely criminal offenses to 50.

Learn more about criminal offense

https://brainly.com/question/11112199

#SPJ2

Based On The Chart, A Young Man Who Has Been A Member Of A Gang For One Year Has Likely Committed About

Related Questions

You can’t get as drunk from beer or wine as you can from hard liquor. Why is the preceding statement a myth?

Answers

Answer:

Many drinkers believe that different kinds of alcohol create different personal reactions. These beliefs are sometimes very old; gin, for instance, was known as "mother's ruin" in 1700s England because it was believed to affect women more than men. However, experts tell Bustle that the idea of experiencing specific symptoms depending on what you're drinking, being "beer drunk" as distinct from "wine drunk," for instance isn't necessarily based on fact.

Is it odd, I tend to get less anxiety around people I dont know too well or such as a newer friend than a family member, or sometimes even feel safer around strangers? mental state of mind kind of problem and matter of opinion but same time This is just a question to waste points

Answers

Not really. I suffer from extreme social anxiety so I am the opposite, being anxious around strangers and more comfortable around people I know. Some people may find being around people who don't know them well less anxiety-inducing because they don't feel forced to open up or show their sensitive side. Just my theory, so don't take my word if you think something else :)  

Answer:

not at all

Explanation:

When your around a family member or someone you are close with you tend to get more anxiety sense they know much more about you. As to a stranger to don't know anything about them and they don't know anything about you, you feel a lot better when you make a mistake or do something embarrassing because you know you will never see them again.  

A state of lawlessness and disorder is considered __________.
A.
an unlimited government
B.
government
C.
anarchy
D.
subversive activity

Answers

Answer:

C. anarchy

Explanation:

Answer:

c

Explanation:

When Josh is participating in outdoor sports, which strategies are effective for preventing heat-related injuries? A drink only when thirsty, wear dark clothing apply sunscreen B wear light clothing, apply sunscreen. drink only when sweating 0 wear light clothing, drink water frequently, take rests in the shade drink water frequently wear heavy clothing, stay out of the shade​

Answers

Answer: c wear light clothing drink plenty of water and take rest in the shade

An auditory disorder that is bilateral

causes a spinning sensation.
→affects both ears

affects one ear.

causes ringing in the ears.
Vertigo is
→a spinning sensation.

a disorder that affects both ears.

a disorder that affects one ear.

ringing in the ears.

Answers

Answer: B affect Both ears

Explanation:edge 2020 :)

Answer:

b

Explanation:

What colour Chopping board is used for fish?

Answers

Answer: Tan.

Explanation:

Answer:

tan

Explanation:

Green: Fruits & Vegetables.

Yellow: Raw Poultry.

Blue: Cooked Food.

White: Dairy Products.

Tan: Fish & Seafood.

Red: Raw Meat.

How can you help reduce violence from school?

Answers

Answer:

Be a pacifist

Explanation:

Try to help your peers or students to talk about their problems and make a compromise

Personality is used to represent how
and ________
one's ______ behavior is.
A. consistent ... unique
B. abnormal ... inconsistent
C. unique ... dysfunctional
D. eccentric ... consistent

Answers

Answer: A

Explanation:

The sentence from your question should be ''Personality is used to represent how consistent and one's unique behavior is'' and that is why the correct answer is answer A).

There is nothing abnormal, dysfunctional, and eccentric in personality description and that is why B, C, and D are incorrect answers.

Personality is considering individual differences between people's behavior, thinking, and feeling.

Answer:

a

Explanation:

edge 2020

What is the HIPAA Security Rule?.

A. It outlines standards for sharing health information verbally.
B. It outlines standards for storing and sharing paper files safely and
C. It outlines standards for allowing patients to view their health
OD. It outlines standards for storing and sharing electronic health
securely.
information.
information in a safe and secure manner.

Answers

Imma say D is the answer

Answer: It outlines standards for storing and sharing electronic health

information  in a safe and secure manner.

Explanation: a  p  e  x

What kinds of vitamins pass right through your body if you take in more than you can use?

A. Minerals

B. Vitamin A

C. Fat soluble

D. Water soluble

Answers

ANSWER

D water soluble

Answer:

Fat Solube

Explanation:

Fat-soluble vitamins (which dissolve in fat), such as vitamins A, D, E and K, are stored in the liver and the body’s fatty tissues when you consume more than you need. Because of this, you don’t have to ingest them every day, and, in some cases, weeks or even months can pass before stores are depleted.

Which of the following describes the position of the inferior vena cava in relation to the abdominal aorta?
A. The inferior vena cava runs perpendicular to the abdominal aorta.
B. The inferior vena cava runs parallel to the abdominal aorta on the right side.
C. The inferior vena cava runs parallel to the abdominal aorta on the left side.
D. The inferior vena cava is inferior to the abdominal aorta.

Answers

Answer:

B. The inferior vena cava runs parallel to the abdominal aorta on the right side.

Explanation:

I majored in Health

Answer:

B. The inferior vena cava runs parallel to the abdominal aorta on the right side.

The endocrine system consists of the bodies blank

Answers

Answer:

The endocrine system is made up of the pituitary gland, thyroid gland, parathyroid glands, adrenal glands, pancreas, ovaries (in females) and testicles (in males), according to the Mayo Clinic. The word endocrine derives from the Greek words "endo," meaning within, and "crinis," meaning to secrete, according to Health Mentor Online.

please mark brainliest if it helps :)

____glands_____

Is the answer

Who saw the meteor hit the dinosaurs

Answers

Answer:

Nobody..?

Explanation:

plz help do in few mins

Answers

Answer:

1÷4+1÷3

3+4÷12

7÷12

0.58

Answer:

b= 8 over 15

c= 7 over 12

Explanation: I used a fraction calculator lol

hope this helps UwU

depression symptoms include: ????????
su!cidal Behavior includes:

Answers

Depression is a mood disorder that causes a persistent feeling of sadness and loss of interest and things that would usually be fun or needful in happiness. Bipolar depression (The most common type) is when you constantly get waves or spikes of fully extreme sadness, but other times you may be very happy.

su!cidal behavior can be many things, su!cidal behavior can be talking about su!cide— for example, making statements such as "I wish I were not living" or "I wish I hadn't been born", being preoccupied with death, dying or violence, feeling trapped or hopeless about a situation, or doing risky or self-destructive things, such as using dr_gs or driving recklessly.

Fake smile you are really tired you fall out of interest of something but keep your mind off what is going on

Hemoglobin is found in which category of proteins?

Contractile proteins

Transport proteins

Defensive proteins

Structural proteins

None of the above

Answers

Answer:

Structural Proteins

Explanation:

Can somebody read this and tell me your opinion on my paper before I submit it? Please.

Answers

Answer:

Really good but just add a little more detail.

Explanation:

Think back to your last “normal” day before everything changed due to this pandemic. What was it like?​

Answers

Answer:

Same as the other guy that answered

Explanation: went to school a normal day when I got home my parents told me we weren’t going back. I was kind of upset tbh I don’t really like any of the kids in my neighborhood so I just sit around at home. It’s very boring

Too much fat in the diet is linked with

A. cancer.

B. strokes.

C. diabetes.

D. heart disease.

Answers

Answer:

c

Explanation:

cant u die of diabetes ? and when your big dont they have diabetes ?

I think D sorry if I am wrong

A large number of nurse researchers and nurse scientists have significant graduate level didactic instruction and possess a master’s or doctoral degree.

True
False

Answers

True because getting a doctoral degree isn’t just to become a doctor. To become a certified nurse research or a nurse scientist, you have to have a masters or a doctoral degree

Type the correct answer in the box
Mention the term
There is no evidence that giving blank to your children makes them hyperactive

Answers

Answer:

soda/ sugar/ coffee/ candy

any of those work.

Explanation:

the answer is sugar yes please

Isaiah wants to begin eating a more balanced diet. He thinks he should consume 2,000 calories each day. Recommended the percentage of carbohydrates, fats and proteins he should consume.

Answers

Answer:

- Carbohydrates: 300 grams per day

- Proteins: 65 grams per day

- Fats: 60-80 grams per day

Explanation:  

Carbohydrates, proteins and fats are fundamental macronutrients that must be consumed daily to maintain a healthy body. Carbohydrates are key macronutrients needed to obtain energy. Moreover, proteins are required to synthesize other proteins (e.g., in muscle cells) and different types of molecules (e.g., peptide hormones). Finally, fats macronutrients are broken into fatty acids which are used by cells to store and obtain energy. In a 2,000 calorie diet, the United States Food and Drug Administration (USDA) recommends the following values:

1) 300 grams of carbohydrates per day, which represent approximately 45-65 % of daily calories (900-1,300 cal)

2) 65 grams of proteins per day, which represent approximately 10-35 % of daily calories (200-700 cal)

3) 60-80 grams of fats per day, which represent approximately 20-35 % of daily calories (400-700 cal). It is important to highlight that it is recommended to avoid high-fat foods (e.g., potato chips) in order to consume healthier fat sources which are rich in omega fatty acids (e.g., salmon, sardines, chia seeds, walnuts, etc).

What is the difference between a person schema and a self schema?
A. Person schemas deal with personality traits, while self schemas deal with social roles.
B. Person schemas deal with behavior during social situations, while self schemas deal with
personality traits
C. Person schemas deal with social roles, while self schemas deal with social aspects and
personality.
D. There is no difference except that person schemas apply to others and self schemas apply to
oneself.

Answers

Answer:

B. Person schemas deal with behavior during social situations, while self schemas deal with

personality traits

Explanation:

Schemas are mental structures people use to organize their knowledge about the social world around them or subjects and that influence the information people notice, think about, and remember. ... A self-schema refers to the mental organization of information that pertains to the self (e.g., shy, independent).

Which is more important, friendship or being a good citizen?
please explain i give brainlest

Answers

Answer:

Being a good citizen because that will help u in the long run

Explanation:

How could a student show a teacher trat he has good character traits?
O by listening attentively in class
O by taking classes he is interested in
O by ignoring the teacher if she trips
O by trying to answer every question in class

Answers

Answer:

A. By listening attentively in class.

Explanation:

I majored in Health

need help really dont get it

Answers

Answer: c

Explanation:

In what ways can a teacher help you to be a successful learner?

Answers

Answer:

take time to realize everyone has different learning methods and has a different learning speed and that they may not get it as quick as you want them to. Be supportive and help them if they don't get a subject as some have a hard time understanding some subjects

Explanation:

Is it pain is temporary, swag is forever OR swag is temporary pain is forever

Answers

Swag maybe permanent but the pain is temporary

The regular doctor patients see for routine checkups and medical treatment is a(n)


what?​

Answers

Pediatricians & Nurse Practitioners do the checkups :)

Answer:

Pediatricians & Nurse Practitioners do the checkups

Explanation:

Good Luckkkk

What is the correct definition of conflict?


A. disagreeing with people who have opposing viewpoints


B. making a choice or solving a problem


C. responding to changes in the body


D. finding a solution to a problem

What is the correct definition of labeling?


1. an act of physical force that results in abuse


2. the ability to accept others for who they are


3. an act of name calling


4. a punishment for someone who is the cause of a strong emotion

Which cause is a common source of conflict for teens at school?


A. being bullied


B. having siblings


C. having curfew


D. wanting more freedom

Which body language can be sign of a conflict?


1. uncrossed arms


2. open fists


3. tight lips


4. arms by the side

Which physical sign indicates a conflict?


A. keeping an even energy


B. feeling like crying


C. wanting to leave


D. having a lump in the throat

Which action is most likely to worsen a conflict?


1. keeping the conflict private


2. respecting one another


3. understanding one's own feelings


4. using drugs or alcohol

What is the last step in peer mediation?


A. Mediator hears both sides of the dispute.


B. People choose a solution that works for both parties.


C. People brainstorm possible solutions.


D. People clarify the needs of each side.

Which step in peer mediation comes before brainstorming solutions?


1. Mediator hears both sides of the dispute.


2. People evaluate each possible outcome.


3. People agree to seek a mediator's help.


4. People clarify the needs of each side.






(sorry i wish i can give more points)

Answers

Answer:

conflict is (a)..... same (a) for bullying...... I hope that helps a bit

Other Questions
Which lines is written in dialect?Don't even think about starting another fight.Are you wanting to pick a fight with me?I reckon youre itchin to fight me, aint you?Youre wanting to fight me again, arent you? (6x+9)(7x+1) find the difference Tell about a time in your life when you were very scared. It can be an event or something you were worried about. 2 sentences.Please put something I have nothing- 2.92 x 10^-15/(5.6 x 10^-3) (4.16 x 10^9) Find the volume of the following figure Nate needs at least 15 pounds of chocolate to make his chocolate fountain work. He already has 8 pounds of chocolate. What is the smallest amount that he can get to make the chocolate fountain work? Write an inequality and solve. Let c represent the amount of chocolate Nate needs to get. Pls pls help I dont have time HELP ASAP. It also detects if its right or wrong. Part i)Which of the following is the best abbreviation for the word Government?a.) GOVMTb.) GVRNTc.) GOVd.) GOV'TPart ii)In 100 words or less, describe what the U.S Government is/does and why it is/isn't so important. Briefly state your beliefs/views and facts about the U.S Government. You may use any and all online resources to answer this question. Include as much detail as possible in your short answer. Which number is irrational? . Complete the quotation:"I am ...with him in this world" From jekyll and Hyde The function of a retail of purchasing cooperative or "co-op" is toCorrect answer A. obtain lower prices for members.Incorrect answer B. work to improve the image and working conditions of members.Incorrect answer C. save income taxes for members.Incorrect answer D. sell the goods or services produced by members. What does it mean to "Psych yourself up?" How does this term affect the meaning of the text Find three ratlos equivalent to the ratio described in the situationThe ratio of cups of water to cups of milk in a recipe is 1 to 4Three equivalent ratlos are 2 to3 to4 to When a cricket ball is thrown vertically upwards, it reaches a maximum height of 15 metres. (a) What was the initial speed of the ball ? (b) How much time is taken by the ball to reach the highest point ? (g=10 ms -2 What caused president roosevelt to sign into law meat Inspection act? who is a better band1:One direction2: 5 seconds of summer 3: BTS4:Little mix5: other Which of the following describes hetereogeneous mixture... 1)A mixture that is easily separated, the components are different sixes and unevenly mixed. 2) A mixture that is very difficult to separate, the contents are evenly mixed and the mixture looks like a substance Light rays from the sun are called: solar energy heat energy chemical energy a circle has a center at (-2,7). if a point on the circle has coordinates (3,-1) then which of the following would be the length of the radius of the circle write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC