Diuretics are chemicals that enhance urinary output. nitrogenous wastes countercurrent exchangers diuretics countercurrent multipliers.
Diuretics, sometimes water pills and Removes salt (sodium) and water from the body called Most of these drugs help the kidneys release more sodium into the urine. Sodium aids in the removal of water from the blood, therefore decreasing the quantity of fluid moving through your veins and arteries.
The nitrogenous waste products excreted by the kidneys are urea and ammonia. Diuretics increase urine output from the kidneys (that is, they promote diuresis). It does this by changing the way your kidneys use sodium. As the kidneys excrete more sodium, they also excrete more water.Diuretics make you pee more often, so take them preferably in the morning.
For more information on Diuretics , visit :
https://brainly.com/question/13020292
#SPJ4
In a transformation experiment, a sample of E. coli bacteria was mixed with a plasmid containing the gene for resistance to the antibiotic ampicillin (ampr). Plasmid was not added to the second sample. Samples were plated on nutrient agar plates, some of which were supplemented with the antibiotic ampicillin. The results of E. coli growth are summarized below. The shaded area represents extensive growth of bacteria; dots represent individual colonies of bacteria. Plates that have only ampicillin resistant bacteria include which of the following?
a. I only
b. III only
c. IV only
d. I and II
Option A, The plasmid containing the amp gene was added to the first sample of E. coli, but not to the second sample. Therefore, only the first sample should contain bacteria that are resistant to ampicillin.
This is represented by the shaded area on the plate I, which indicates extensive growth of bacteria. Plates II, III, and IV do not have any shaded area, meaning that there is no extensive growth, and only dots representing individual colonies of bacteria.
Since the plasmid was not added to the second sample it does not have resistance to the antibiotic. This means that plates III and IV, which contain the antibiotic, will not have any ampicillin-resistant bacteria and thus the answer is a. I only.
To learn more about E. coli bacteria at
https://brainly.com/question/18722309?referrer=searchResults
#SPJ4
Which of the following expalins why folate is critical to the health of a newly conceived embryo?
A. Folate is essential for heart function
B. Folate is essential for maintaining prioper fluid balance
C. Folate is needed for spinal cord formation
D. Folate regulates bone formation
Answer:
I believe the answer is D. Folate regulates bone formation.
Explanation:
Hope it helps:)
State one way the two molecules could differ that would explain the difference in their ability to pass through the artificial plant cell membrane.
The two molecules could differ which would explain the difference in their ability to pass through the artificial plant cell membrane because molecule A is smaller than molecule B.
There аre multiple fаcts thаt cаn justify thаt two molecules show the difference in their аbility to pаss through а membrаne:
Size аnd moleculаr weight Receptors on the membrаne аnd the moleculesStructure of the membrаneMembrаne аffinityDifferent molecules hаve different solubility depending upon the type of molecule аnd membrаne. So, the two molecules could differ which would explain the difference in their ability to pass through the artificial plant cell membrane because of the size of the molecules.
For more information about the size of molecules refers to the link: https://brainly.com/question/20556821
#SPJ4
How is it possible to take a cell with 46 chromosomes and create 4 cells with 23 chromosomes each?
TRUE/FALSE: Food webs are the best depictions of feeding relationships because they show many ways that plants and animals are connected.
Answer:
True
Explanation:
Food webs are the best depictions of feeding relationships because they show a single path for the flow of energy through an ecosystem.
what is the similar between an estuary zone and intertidal zone
An estuary zone and an intertidal zone are both areas along the coast where freshwater and seawater mix. Both are affected by the tidal movements of the ocean and support a wide variety of plants and animals adapted to living in these environments. Both estuaries and intertidal zones are important ecosystems that provide habitat for many species and support economic activities such as fishing and tourism. They are also vulnerable to pollution and other human impacts and are often protected and preserved
A parent cell has 28 chromosomes and completes meiosis. How many chromosomes result in each cell produced
If a parent cell has 28 chromosomes then the number of chromosomes in the daughter cell produced after the cell undergoes meiosis is 14 chromosomes.
Meiosis is a cell division process for gamete production. It helps in the sexual reproduction of eukaryotes. Gametes produced from two parents will unite to form the zygote, which thus contains a combination of unique sets of chromosomes inherited from two parents.
Hence each daughter cell will have half the no of chromosomes as that of their parents. So the number of chromosomes in each of the daughter cells is 28/2 = 14 chromosomes. In meiosis 1 the number of chromosomes becomes half while in meiosis 2 , it is similar to mitosis, so the number of chromosomes remains the same.
For further learning about meiosis, follow the link:
https://brainly.com/question/30080589
#SPJ4
Does a green leaf absorb or reflect blue light?
A green leaf absorbs blue light and reflects green light. Chlorophyll, the pigment primarily responsible for the green color of leaves, absorbs light most efficiently in the blue and red parts of the spectrum.
It absorbs blue light and reflects green light. The chlorophyll reflects green light, which is why leaves appear green. This is because chlorophyll absorbs light in the blue and red regions of the spectrum because these are the wavelengths of light that are most useful for photosynthesis. A leaf that appears darker in color will absorb more light than a leaf that appears lighter in color, because a darker leaf has more pigments that can absorb light. However, it is important to note that a leaf's color is not the only factor that determines how much light it can absorb. The thickness of the leaf, the angle of the light, and the presence of other substances on the leaf surface can also affect how much light the leaf can absorb.
Learn more about leaf absorb here:
https://brainly.com/question/27705091
#SPJ4
Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA
ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.
What is DNA?Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.
The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.
Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.
Learn more about DNA, here:
https://brainly.com/question/21992450
#SPJ1
What are the 3 main species that make up the mollusk group?
The three main groups of mollusks are bivalves, gastropods, and cephalopods. Out of which Gastropod is the largest class.
In general, gastropods include snails and slugs. Bivalves are having hin.ged shells also called val.ves examples include clams, mussels, and oysters. Cephalopods include the octopus and squid.
The phylum Mollusca has many distinctive features and special characteristics, which include a mantle cavity, visceral mass, foot, and radula. Gastropods have a special characteristics that includes spirally-coiled external shell while others mollusks usually have a flattened shell, and many of them doesn't possess any shell as outer structure.
To learn more about Mollusks , here
brainly.com/question/28737614
#SPJ4
Organisms are classified into kingdoms primarily on the basis of A) behavior B) structure C) size D) habitat
Organisms are classified into kingdoms based on a variety of factors, but primarily on the basis of structure, behavior, size, and habitat. So all the given options are correct.
First and foremost, structure is the most important factor in determining the kingdom to which an organism belongs. Morphology, or the physical structure of an organism, plays a vital role in the classification process. For example, the vast majority of animals are classified as members of the Animalia kingdom, due to their possession of a backbone and other characteristics that distinguish them from other organisms.
Behavior is also used as a criterion for kingdom classification. Organisms are grouped into different kingdoms based on the behaviors they exhibit, such as their mating habits, feeding behavior, and even their social organization. For instance, many fish, birds, and mammals are grouped together in the Animalia kingdom due to their similar behaviors.
Size is another factor that is taken into consideration when classifying organisms into kingdoms. Generally, larger organisms are grouped in the Animalia kingdom, while smaller organisms, such as bacteria and protists, are placed in the Protista kingdom.
Lastly, the habitat of an organism is also used to assign it to a certain kingdom. Different kingdoms are characterized by certain habitats, such as the Animalia kingdom is associated with land-based habitats. Thus, when an organism is found to live in a certain habitat, it is generally assigned to the kingdom associated with that habitat.
Learn more about Protista kingdom at :https://brainly.com/question/25148693
#SPJ4
compare the air pollution of Uttar Pardesh, Arunachal Pradesh, and Meghalaya
Answer :uttar Pradesh is more polluted than any of these.
Explanation:
8. Last July, the body of a 16 year old male was found in his car. The body exhibited rigor in the legs, but no rigor in the upper torso. The ambient temperature inside the car registered 102°F. Explain the approximate TOD for this situation.
In this situation, the time of death (TOD) can be estimated by examining the evidence of the body's condition. Rigor mortis, the stiffening of muscles after death, is one of the most reliable indicators of the approximate TOD. The fact that the body of the 16 year old male exhibited rigor in the legs, but not in the upper torso, implies that the body had been in the car for a period of time during which it could have been affected by the ambient temperature.
Rigor mortis usually sets in 2-6 hours after death, and its effects can be seen in the body's muscles for up to 12 hours. As the ambient temperature in the car was 102°F, the body's muscles would have stiffened due to the heat, leading to an accelerated onset of rigor mortis. This means that the TOD for this situation is likely to have been within 2-6 hours of the body being discovered, assuming that the ambient temperature had been stable for the duration of the body being in the car.
For more information on TOD , visit :
https://brainly.com/question/27853645
#SPJ4
2. What is the resting phase for cells that are currently not in the process of division or cells that do not intend to divide, such as the nerve
cells in your brain?
Go
G2
Os
G₁
Answer: Go, all the other options are stages that involves changes to the cell during the cell cycle (e.g., G1/G2 = cell growth, and processes involving the organelles, Synthesis = DNA replication)
For every described currently living species of organism, there are about ________
fossil species.
O 2
O 1/6
O 100
O 6
O 1/100
For every described currently living species of organism, there are about 1/6 fossil species.
What is fossil species?Fossil species are species that have been preserved in the fossil record. Fossil species are usually the remains of ancient organisms that lived millions of years ago, and are found in sedimentary rocks. They provide a window into the evolutionary history of the Earth, and are important for understanding the relationships between extinct and living species. Fossil species are also used to reconstruct ancient environments and ecosystems. Fossil species can be identified by their morphology, or physical characteristics such as size and shape.
To learn more about fossil species
https://brainly.com/question/11829803
#SPJ1
Which of the following has no effect on the outcome of the host-parasite relationship?
A. The number of parasites on or in the host
B. The virulence of the parasite
C. The defenses of the host
D. All of these have an effect on the outcome of the host-parasite relationship.
Answer:
C. The defenses of the host
PLSSS HELP IF YOU TURLY KNOW THISS
Answer:
It's A.
Explanation:
Because owls and hawks have different Pray to catch and different species
Why do whales need oxygen?
Whales need oxygen for respiration processes because they do not have gills, and whales are unable to breathe oxygen that is dissolved in water.
The lack of gills, which prevent whales from breathing oxygen dissolved in water, is the most obvious distinction between whales and other fish. Instead, they have lungs, which means that whenever they want to breathe air, they have to come to the surface.
They can stay underwater for hours at a time because they have a very efficient respiratory system that allows their lungs to get the most out of each breath. To put things in perspective, when we are at rest, humans breathe about 12 to 20 times per minute, but they only take in 5% of the oxygen in a single breath. This is in contrast to a whale, which can absorb up to 90% of the oxygen it breathes. This indicates that a whale takes in significantly more oxygen in a single breath than a human does.
Know more about Respiration here: https://brainly.com/question/12605249
#SPJ4
Please helppp me its due tomorrow’s ‼️‼️ ☹️☹️
I only need help with g. It’s the last one
Thank youuu sooo muchhh
the answer to your question is yes
How will the positive and negative transcription factor help maintain the homeostasis of the body system. Explain with an example
The positive transcription factor will help in maintaining the stimulus for homeostasis or even accelerate it. Whereas the negative transcription factor will oppose the effect of the stimulus, it can either increase it or decrease it.
Homeostasis is the maintenance of a steady and equilibrated physical, chemical and internal state of the body. The example of positive transcription factor is: activation of one clotting factor in the body initiates a cascade for the activation of all the other clotting factors.
Negative transcription factor has the example of blood glucose levels of the body. If the level increase transcription factors cause the release of insulin from the pancreatic cells to maintain the homeostasis.
To know more about homeostasis, here
brainly.com/question/3888340
#SPJ4
What is the danger of engaging in unprotected pre marital sex?
Engaging in unprotected premarital sex can be dangerous as it increases the risk of sexually transmitted infections (STIs) and unintended pregnancies, and can also have emotional and mental impacts.
Engaging in unprotected premarital sex can be dangerous because it increases the risk of sexually transmitted infections (STIs) and unintended pregnancies.
STIs, such as HIV, chlamydia, and syphilis, can be transmitted through unprotected sexual contact. Some STIs can cause serious health problems and even death if left untreated. Some STIs, like HPV or herpes, may not show any symptoms, but can still cause long-term health issues.Unintended pregnancies can also occur as a result of unprotected premarital sex. This can lead to a variety of personal, social, and economic challenges, including emotional and financial burdens, interruptions to education or career plans, and the need for parenting or adoption arrangements.Additionally, unprotected premarital sex can also have emotional and mental impacts, such as guilt, regret, or emotional distress.It's worth noting that practicing safe sex, including the use of condoms and other forms of contraception, can greatly reduce the risk of STIs and unintended pregnancies, as well as emotional and mental distress.To learn more about unprotected pre-marital sex at
https://brainly.com/question/29795968?referrer=searchResults
#SPJ4
How do we know whether or not a heteromorphic chromosome such as the Y chromosome plays a crucial role in the determination of sex
The Y chromosome contains the "male determining gene," the SRY gene. This gene causes testicles to form in the embryo and results in the development of male genitalia. The SRY gene is important in sex determination in mammals and some insects.
Chromosomes are part of the structure of the human body, which consists of DNA and other molecules, and is the place where genetic material is stored.
To determine sex, the so-called X and Y chromosomes. If the embryo's chromosomes are XX, then it is female. Conversely, if the XY chromosome then the fetus will be born as a boy
Sex chromosomes are usually heteromorphic, that is, they show differences (size, shape, or reaction to staining) between their homologous chromosomes. Individuals having heteromorphic sex chromosomes can produce two types of gametes. For example, human males can produce gametes that have 22+X or 22+Y chromosomes.
Learn more about the Y chromosome at https://brainly.com/question/21057614
#SPJ4
2. Experiment: Click Play and hunt peppered moths on dark tree trunks for five years. In each
year, try to capture as many moths as you can.
When you are done, select the TABLE tab and record the percentages of each moth type.
Year
Dark moths
Light moths
o
1
2
3
4
5
The total number of moths captured yearly is five. Inwhichoneis light moths and the other three are dark moths.
Moths come in a wide range of sizes, with wingspans that range from roughly 4 mm (0.16 inch) to nearly 30 cm (about 1 foot). They are highly adaptive and can survive anywhere but in arctic regions. Moths have scale-like coverings on their wings, body, and legs that fall off when the insect is handled. Moths have sturdier bodies and duller coloring than butterflies. Moths also have recognizable thick or feathered antennae. Moths retain their wings stretched at their sides or folded tent-like over their bodies when at rest, whereas butterflies hold their wings upright.
Learn more about moths here:-
https://brainly.com/question/15101218
#SPJ4
Advantages and disadvantages of Biomass energy in our social world
The advantage of bioenergy is a reliable type of renewable energy where harvesting biomass for electricity can also help us reduce waste but the disadvantage when compared to other sources of electricity, is the cost of collecting, transporting and storing biomass which can be expensive to do.
What is Biomass energy?Biomass is defined as plant-based material which can be used as a fuel for heat or electricity generation that includes wood, wood residues, energy crops, agricultural residues, and waste from industry, farms, and households.
This energy is the use of organic matter to generate electricity where energy is produced by burning organic matter that comes from plants and animals.
Thus, the advantage of bioenergy is a reliable type of renewable energy where harvesting biomass for electricity can also help us reduce waste but the disadvantage when compared to other sources of electricity, is the cost of collecting, transporting and storing biomass which can be expensive to do.
Learn more about Biomass energy, here:
https://brainly.com/question/82777
#SPJ1
What will happen in the future if we keep on using our non-renewable resources?
The most well-known impact of using non-renewable energy sources is the emission of greenhouse gases such as carbondioxide gas etc.
What will happen if we continue to use non-renewable resources?We pursue to use of non-renewable resources, in specific, carbon dioxide and methane give to climate change. Different types of non-renewable energy fuels emit high levels of greenhouse gases.
Minerals is used for making metals which are also non-renewable natural resources. Nonrenewable natural resources take extended than a person's lifespan to be returned. In fact, Non-renewable energy can take millions of years to form. Fossil fuels such as oil, coal, and gas will not last forever.
So we can conclude that The problem with non-renewable energies is the ecological impact of non-renewable energies · The fuel of climate change.
Learn more about non-renewable here: https://brainly.com/question/19882326
#SPJ1
What is an irony definition?
Definition of irony as a narrative character is a scenario in which there is a contradiction between expectations and reality.
A scenario in which there is a contradiction between expectation and realities is what literary irony is defined as. For instance, the contradiction between what something seems to signify and what it actually means. Tragic and comic events are both connected to irony.
The word "irony," which first appeared in the English language in the sixteenth century, is derived from the Latin word "ironia" and the French word "ironie." All of these expressions have their roots in Eiron, a stereotypical figure from ancient Greece. An Eiron figure defeats his adversary by exaggerating his weaknesses, partaking in a form of irony by expressing less than what he really means.
You can also learn about irony from the following question:
https://brainly.com/question/1695719
#SPJ4
What is the best evidence we have for evolution ?
The continuity of the fossil record from ancient to contemporary times may be the strongest fossil evidence supporting evolution.
We don't find things like mammals in strata from the Devonian, the age of fishes, or human fossils alongside dinosaur remains anywhere on Earth. Evolution that is, common descent, gradualism, species diversification, and natural selection are the five hypotheses that Darwin united. A theory is an explanation for how a natural phenomenon functions that has undergone extensive testing through observations and experiments intended to establish the validity of the explanation. In this context, evolution might be considered both reality and a theory. The fact that creatures have altered or evolved over the course of Earth's history is undeniable.
Learn more about Evolution here:
https://brainly.com/question/6111443
#SPJ4
Permanent hardness of water can be removed by adding
A. chlorine
B. washing soda
C. potassium permanganate
D. bleaching powder
Washing soda can be added to water to dissolve any lingering hardness.
The presence of dissolved calcium and magnesium ions contributes to the hardness of water. Temporary hardness and permanent hardness are the two different types of water hardness. Boiling the water makes the dissolved calcium carbonate precipitate out as calcium carbonate, which can be used to remove temporary hardness. On the other hand, permanent hardness is brought on by the existence of dissolved calcium and magnesium sulfates and cannot be eliminated by boiling.
Water hardness can be eliminated permanently with washing soda, sometimes referred to as sodium carbonate. By interacting with the dissolved calcium and magnesium ions to create insoluble precipitates, it softens the water.
A,C and D options are not correct. Chlorine is used to disinfect water, but it doesn't remove hardness. Potassium permanganate is a strong oxidizer and can be used as a disinfectant and treatment for certain water impurities, but it also doesn't change the hardness of water. Bleaching powder is used as a disinfectant and oxidizer, but it doesn't have a role in changing the hardness of water.
Learn more about hardness of water:
https://brainly.com/question/28178305
What is the percentage of having tall pea plants in the offspring?
The percentage of having tall pea plants in the offspring is about 75%
A person who has two copies of the allele that codes for the dominant characteristic is said to be homozygous-dominant for that trait. This allele, which is sometimes referred to as the "dominant allele," is typically denoted by the uppercase version of the letter used for the associated recessive characteristic (such as "P" for the dominant allele producing purple flowers in pea plants). An organism's genotype is symbolized by a doubling of the trait's symbol, such as "PP," when it is homozygously dominant for that trait.
Refers to a trait that can only be seen in homozygous individuals; it is a trait that is often hidden by other inherited qualities but persists in populations of heterozygous individuals.
To learn more about Mendel theory :
https://brainly.com/question/930312
#SPJ4
how can the silent march best be described the silent protest
Answer:
There is no singing or chanting, just the muffled thump of drums.
Explanation: