answer this riddle


what is used less and less but is made from growth ​

Answers

Answer 1

Answer:

Explanation:

Grow?


Related Questions

What are the examples of your work known as?
A) A portfolio
B) A vitae
C) A syllabus
D) A layer

Answers

Answer:

a portfolio :)

Explanation:

PLS HELP, DUE IN AN HOUR! What aspects influence the design and production of an object design?

Answers

Answer: Some of the benefits product design can offer include:

improve the quality of life of the user;

give an improved performance over previous models;

provide the user with status;

minimise manufacturing costs;

create new markets or expand existing markets;

increase the manufacturer’s profitability;

make economic use of resources;

create a new or better aesthetic.

Explanation:

Hope that helps.

PLEASE ANSWER QUICKLY

In two to four paragraphs, explain what happened musically as Britten introduced the orchestral instruments. Include a discussion of:

the order in which the instruments introduced the theme, as heard in the first 2:00 minutes of the piece;
why the composer might have chosen to use different sections of the orchestra to play at different times; and
how this piece helps you gain a better understanding of the orchestra

Answers

Answer:

Benjamin Britten uses a plethora of different instruments and sounds in his piece, " "The Young Person's Guide to the Orchestra." Britten incorporates all different types of instruments and makes each sound mesh together even if it's not in the most traditional way. Britten first goes in with the woodwind instruments consisting of flutes, oboes, the bassoon,  and the clarinet. After the woodwinds, Britten moved to the strings. The strings consisted of pianos, harps, first and second violin, violas, cellos, and basses. After he was through with the strings, he incorporated the brass instruments like the french horns, trumpets, trombones, and tubas. Lastly, he went in with all the percussion instruments such as the timpani, drums, and triangle. Britten made sure that each timbre was clear by playing the highest pitch instrument in each section so people knew which part of the orchestra was playing. He starts off with the melody being played by the whole orchestra and then breaks it down into segments so each group has a chance to shine.

Explanation:

ok question of the day. if you can guess what color shirt i am wearing on the first try i will mark you brainliest

Answers

Answer: Black

Explanation:

how does breathing helps you sound better when you're singing.​

Answers

Answer:

It helps you sound like you are not running out of air, and helps you hold notes longer

GUYS JUST TELL ME WHAT TP WRITE I ALREADY WROTE THIS KUCH I DONT KNOW WHAT SENTENCE TO WRITE FOR THIS PART...... FINALLY YPU CAN.... ITS ABOUT POOLS OR BEACH I PICKED BEACH

Answers

Answer:

I'd say "finay you can collect seashells and fantastic rocks that you wouldn't find at a pool.

The Shins and Death Cab For Cutie represent which of the following types of
bands?
O A. Grunge
B. Boy band
C. Emo
D. Punk rock

Answers

Answer:

C) emo

i hope its right lol

C)emo
I think that’s the awnser

Which of the following is enharmonic note for the new shown above?

Answers

Answer:

d sharp which is the 1 option

Explanation:

d sharp same fingering as e flat

There was option first  is the enharmonic note for the note shown above. Thus, option (a) is correct.

What is enharmonic note?

The term enharmonic note was the improvement in the readability of a line of music. It was a sequential order to improve the learning of the music note. The sequence of the ascending to descending order. There are the different in the note are the different of the sound.

According to the diagram was the shown on the enharmonic note. The notes are the similar into the minor of the differences. But, the sound was different on the different key. The written notes are said to be enharmonic. The enharmonic note is to represent on the piano (C = B, E = F, D = C )

As a result, the enharmonic note for the note shown above. Therefore, option (a) is correct.

Learn more about on enharmonic note, here:

https://brainly.com/question/10027171

#SPJ5

Where does grandma sands live?

Answers

Answer:

Birmingham

Explanation:

did it before

Hurry will give Brainliest!!! Which qualities were represented in Neoclassical works?
Dramatic scenes, exotic subjects, much emotion
Depict people of all classes, scenes of ordinary life, popular due to photography
Noble, stoic, courage, patriotism

Answers

Answer:

b and c

Explanation:

PLS HURRY!!
Can you tell how many different notes are played at a particular time (chords)? for manic by conan gray

Answers

Answer:

Three distinct notes

Explanation:

Answer:

I only know the chords for guitar not uke

Explanation:

I need the answer for these questions plz

-1. Choose a quote from the text that supports the following statement, and record it on the lines below. Alvin Ailey used his background to influence the way he danced

-2. What is the main idea of Alvin Ailey? Write it in your own words.

-3. What can you infer about Alvin Ailey based on his decision to include people from all different backgrounds in his dance company?


-4. Describe what the author means when the text says, “Alvin prided himself on hiring dancers based on their talent, and not the color of their skin.”

-5. How has Alvin Ailey’s work continued today after his death

-6. When Alvin Ailey noticed that the dance world was strange and lacked freedom, what did he decide to do?

- 7. What are some examples of Alvin Ailey’s kindness and compassion? Include two pieces of evidence from the passage.

A)



B)

Answers

Answer

nes below. Alvin Ailey used his background to influence the way he danced

-2. What is the main idea of Alvin Ailey? Write it in your own words.

-3. What can you infer about Alvin Ailey based on his decision to include people from all different backgrounds in his dance company?

-4. Describe what the author means when the text says, “Alvin prided himself on hiring dancers based on their talent, and not the color of their skin.”

-5. How has Alvin Ailey’s work continued today after his death

-6. When Alvin Ailey noticed that the dance world was strange and lacked freedom, what did he decide to do?

- 7. What are some examples of Alvin Ailey’s kindness and compassion? Include two pieces of evidence from the passage.

A)

B)

Explanation:

nes below. Alvin Ailey used his background to influence the way he danced

-2. What is the main idea of Alvin Ailey? Write it in your own words.

-3. What can you infer about Alvin Ailey based on his decision to include people from all different backgrounds in his dance company?

-4. Describe what the author means when the text says, “Alvin prided himself on hiring dancers based on their talent, and not the color of their skin.”

-5. How has Alvin Ailey’s work continued today after his death

-6. When Alvin Ailey noticed that the dance world was strange and lacked freedom, what did he decide to do?

- 7. What are some examples of Alvin Ailey’s kindness and compassion? Include two pieces of evidence from the passage.

A)

B)

LOCK #2 The answer to the second lock is the number of self-portraits Van Gogh painted between the years of 1886 and 1889, (SEE HELPFUL LINK IN CLUE) PLUS the number of self-portraits shown in the video in the special exhibition gallery. (CLUE 2)

Answers

Answer:

sorry just here for the points

Explanation:

Ted is a still-life photographer and wants to photograph a fruit bowl indoors. Which recommended practice should he follow?

A. He should photograph in the afternoon and let sunlight fall directly on the fruit.

B. He should use a diffuser to soften the direct light falling on the fruit.

C. He should avoid using mirrors because they would result in a sharp glare on the fruit.

D. He should position the fruit bowl in front of a table full of vegetables.

Answers

Answer:

The answer is the first one- A

All artists go to college for visual arts.
A.
True
B.
False

Answers

Answer:

well not actually true you can go anywhere for arts

Explanation:

A is true they do have to go

Which of the following is enharmonic note for the new shown above?

Answers

Answer:

d flat so the first option

Explanation:

c sharp has the same fingering as d flat

Help ASAP
What was the Treasury of Atreus?

Answers

Answer:

d

Explanation:

This is because he was always find of gold

Answer:

Its A: The Treasury of Atreus or Tomb of Agamemnon is a large tholos or beehive tomb on Panagitsa Hill at Mycenae, Greece

Music sales are considered in the Billboard ranking of music.
A. True
B. False

Answers

Answer:true

Explanation:

Answer:

True

Explanation:

Put these art movements in the order in which they developed from earliest to most recent.
Baroque
Neoclassicism
Futurism
Realism

Answers

Answer:

Correct order is:

Baroque

Neoclassicism

Realism

Futurism

Explanation:

Baroque developed since the early 17th Century until middle of 18th Century.

Neoclassicism developed since the middle of 18th Century, through 19th Century.

Futurism started developing in the early 20th Century.

Realism developed in the 19th Century.

what are the two main reasons synchronized sound, specifically dialogue, was difficult early on?

Answers

A sound film is a motion picture with synchronized sound, or sound technologically coupled to image, as opposed to a silent film. ... At first, the sound films which included synchronized dialogue, known as "talking pictures", or "talkies", were exclusively shorts.

Please mark brainiest if this helped!!!

HELP PLEASE
The Neolithic period is categorized by...

A hunting and gathering food
hunting and the
B domestication of the dog
C domestication of plants and animals
D attribution of magical properties

Answers

The Neolithic period is categorized by C domestication of plants and animals.

What was the  Neolithic period?

Neolithic period can be described as the era that comes with the introduction of the metallurgy which started in the region of china around the year 10000 BC which involves the process whereby people begin to seek for different animals so they can have them.

It should be noted that this era can be seen as one that can be characterized as one that involves the activities of farming and domesticated animals where people can now use some of the little available equipment for their farming activities.

Therefore, option C is correct.

Learn more about Neolithic period  at:

https://brainly.com/question/8101648

#SPJ1

ANSWER THESE CORRECTLY FOR BRAINLY (band)

When counting eighth note rhythms, the eighth note that lands on the down beat always gets a _______

and the eighth note that happens on the upbeat uses the word _____

Answers

Answer:Rhythm1

Notes Have Duration

Rhythm is the different durations of tones (sound). Though tones change pitch, each has a duration. These time durations are symbolized by the shape of a note.

To begin counting rhythm, we should know the different note shapes. Two note types are a quarter note and an eighth note. The quarter note is a full beat in a measure. The eighth note is a half of a beat, or a half beat.

Here are four measures of mixed quarter notes and eighth notes. Each measure has four beats, counted 1 2 3 4. Since eighth notes cannot make a whole beat, the rest of the duration of a beat is counted & (and). So we can count a measure as:

The eighth notes are tied together by a beam (connecting them, in place of each flag). Notice there is no '&' after a quarter note. The quarter note is still sounding until the next downbeat. Mentally, though, you can think of its total beat as '1 &', or '2&', etc. Keeping a constant pace in your head by mentally counting '1&2&3&4&' is a good idea. This helps to predict where, in time, the beat falls.

Add a total half beat (eighth note) to another total half beat, and it equals a whole beat (quarter note). Don't stop counting the whole beat until the beginning of the next beat, because we need both of the half beats when we say '1&'.

Another good idea is tapping your foot, because the downbeat falls when your foot touches the ground, and the upbeat is when your foot is all the way up. Personally, I pulse my toes because it's faster and quieter. Do whatever works to help you keep the beat within the tempo (the even duration of all the measures).

Rhythm Interpretation

Rhythm may be interpreted in different ways, which is exciting. The above picture of four measures, may be divided into logical musical phrases.

One interpretation of this rhythm, is that the first four quarter notes are an introduction (four solid downbeats mark out the rhythm and tempo). These beats may crescendo to open up the next measure. After the intro, the second measure seems to begin the song, with a strong first count.

Next measure, two identical phrases echo each other. Their two eighths introduce two strong quarter note downbeats. Play the eighths softer than the two quarters for more effect. This repetition, coupled with the downbeats in different parts of the measures, creates suspense.

The fourth measure has two eighths for the first beat. This begins a new rhythmic phrase that grew out of the last one. The new phrase is four eighths and a quarter, repeated. After the second four eighth notes, there's no downbeat yet, but we may assume it's going to be a quarter note that ends the phrase.

You may interpret the rhythm in a different way, which is perfect. Employ whatever way helps to keep track of the beat and tempo. Learning is easier with a collection of reference points.

Finally, here's my interpretive breakdown of the four measures:

1 2 3 4 1 / 2& 3 4 1& 2 3 / 4&1& 2 3&4& (1)

//// / --//--// ----/----(/)

Also, instead of using numbers to identify the rhythm, we can play a sound. It's easier to remember the phrase if we can quickly hear it. Play it at a fast or slow tempo to get a sense of the phrase.

Together, these phrases may feel like an incomplete rhythm pattern, since only three phrases appear, waiting for the fourth to make a bar. It's interesting that even with our strong downbeats, the music can seem incomplete, until we satisfy our sense of timing with another rhythm, based on a bar of 4 in this instance.

Notice that measure barlines | |, demark an equal duration of measured time. However, notes travel along this musical 'sidewalk' in meaningful phrase groups, unaware of barlines. This sense of rhythm is beyond written measures, especially when our last phrase's rhythm doesn't fall on a downbeat.

Just as melodies are phrases of notes that relay ideas to us, rhythm supports the total idea of a song. We break up phrases into measured segments, to reproduce musical thoughts. Both note phrases and rhythm work together. Spiritually speaking, music is never just symbols on a page, but inspiration.

NCT U - 90s Love (English Translations)
Hey, hey, hey, hey, hey, hey (Hoo, hoo)
Hey, hey, hey, hey, hey, hey (Hoo, hoo)

1990's (How we do it)
Some things last forever (They say)
We like to keep it cool (Our way)
Now, who's the hottest? (Boy)
Can you feel it too? (How we do it)
This is an old school vibe (That vibe)
Singing along with kids on the block (On the block)
Boombox rockin' the alley, make some noise

The meaning of time I've never seen
I walk along the orange Apgujeong street
If you feel this too, come and find me
Thе world is moving again
Take it out, take it out
Take it out, takе it out, it's fun
You and I here
With your and my style
(Let's show it off like the '90s)

This is how we do it everything here
Woo, what you waitin' for?
Bring a new romance
Woo, we about to go
We want
Here we go, here we go, ay
(We want) We want
Here we go, here we go, oh
That 90's love (That 90's love)

Don't this hit really feeling like jump, jump
Don't this hit this is our own mood
Don't this hit really feeling like jump, jump
Don't this
The streetwear that swept across the block
Now it's just a classic (Blow that)
My pocket was loose (I show that)
Now, let's shoot, cheese (Clack)
Friends in the film all make V (You know that)

Let's go mob your moves, stay here, yeah
Fresh off, new decades heating up again
I stay up all night watching "Friends" like my friends
Maybe we're on the same parallel line

Listen, DJ drops it (Drop)
You can't avoid this feeling (Feel a way, feel a way, what)
Cause the night is short
So let me see you do your thang (Come on)

The meaning of a space I've never been in
We feel each other's presence, 90's love
When you become stronger, come and find me
Beyond the KWANGYA, come closer
Take it out, take it out
Take it out, take it out, it's fun
Here you and I
With you and my style
That's who we are, put it down like that
(Let's show it off like the '90s)

This is how we do it everything here
Woo, what you waitin' for?
Bring a new romance
Woo, we about to go
We want
Here we go, here we go, ay
(We want) We want
Here we go, here we go, oh
That 90's love (That 90's love)

Don't this hit really feeling like
Tonight the new clash
The wave is spreading (It's growing, yeah)
I felt the KOSMO I could almost reach to
Let me show you 90's love
That's who we are
Let me show you 90's love

This is how we do it everything here
Woo, what you waitin' for?
Bring a new romance
Woo, we about to go
We want
Here we go, here we go, ay
(We want) We want
Here we go, here we go, oh
That 90's love (That 90's love)

Answers

The heck that’s crazy

I will give BRAINLIEST!!!!

Which of the following is the enharmonic note for the note shown above?

Answers

Answer:

Option 2

Explanation:

Your answer is going to be the second one

How is the commercial aspect of art different today than during the Renaissance? Hurry please. 100% = Brainly

Answers

Answer:

Most art during the Renaissance period was done by commission. A patron came to the artist and told them what it was that they wanted, and all aspects of the transaction were hashed out ahead of any actual creative work being done: pay, time to complete the work, what medium would be used, and the subject of the work. A Renaissance era artist had the advantage of knowing ahead of time all he would need to complete such work, at the disadvantage of very little artistic license. More modern artists, mostly working for their own benefit and with their own creative drive powering their work, must work absent this same "patronage", and create what is popular or likely to sell and assign a value to their own work based on prevailing market value and demand.

Explanation:

Answer:

The commercial aspect of art is different today than during the Renaissance because during the Renaissance major artists and artwork were focused on churches and cathedrals. During the Renaissance the Catholic Church were a major patron of the arts unlike today. Along with most of the artwork being about churches, most artwork during the Renaissance was commissioned by the wealthy merchant families of Florence like the Medici family for example. But today, most artwork is sold and showed off in museums or art shows and are being sold for way more than during the Renaissance.  Modern art unlike Renaissance art is unique, each artwork is different and uses a different style, it doesn't revolve around the same aspect like Renaissance art with their cathedrals.

:for anyone who still needs an answer:

Peter is a middle-aged overweight man who is trying to decrease his body circumference how could the serving size on a nutrition label help him lose weight

A. It describes how many daily total calories he should eat. He can compare this number to the number of calories he currently consumes

B. It allows him to predict how much weight he will lose if he follows the serving size guidelines on the nutrition label

C. It describes the portion size of the food that he should eat. This amount can be used as a guideline for preparing food

D. It defines how much food he can eat when dining at restaurants and still be able to lose weight

Answers

Answer:

C

Explanation:

C because it describes how much he eats and the amount and portion of what he should eat but if it’s the portion size he needs it should be C

photography
1. How are Johansson’s photographs different than most others?
2. What makes his photographs seem real?
3. What rules does Johansson follow in his photography?
4. Which of Johansson’s creations did you like the best? Why?

Answers

Answer:1 . a.He uses editing to make some type of illusion or different perspective of a lens

2. This doesn't seem to happen at all or not nearly, to the same ... to make the photos look more like paintings and less "real.

3. His golden rules when creating an impossible photograph are broken down in three simple guidelines: All of the images must be taken from the same perspective. All of the images must be taken using the same lighting. When combining the images, the results must be seamless.

4. My favorite one of Johansson's creations was the big fish under the water with golden fish

Explanation:

ily say it back

A 2 paragraph summary of the music in todays inaigration

Answers

What what do you mean like is that a book

Can anyone help me with this? The instructions are to type in any missing solfege syllables under each pitch

Answers

Answer:

1 st one is : fa so do so mi fa so re mi fa ti fa re mi fa

Explanation:

Slip is made of what two parts?

Answers

Answer:

Clay and/or other materials suspended in water

Explanation:

Slip – a liquid suspension of ceramic particles in water. porcelain – a ceramic, which is often used in cooking and dishware, made up of a mixture of clays. mold – the shaped cavity which is used to form another material into the desired shape.

Answer:

slurry of clay and/or other materials suspended in water

Explanation:

Other Questions
PLEASE HELP I NEED THE ANSWER QUICK!!! What is the Length/ value of N is 63 / 168 equivalent to 312 / 832 Which Pope wanted to liberate Jerusalem from Muslim control? A 14.0 tank contains 250 g of methane (CH4) gas at 27 atm at 298 K. Accidentally, 190 g of CO2 was added to the tank. What will be the resulting pressure of the mixture in the tank? Assume that no CH4 leaked out as the CO2 gas waa being added. Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) PLEASE HELP!! I'LL GIVE BRAINLEST!!Use the formula P = 2l + 2w. Find the perimeter of a rectangle with a length of 12.9 ft and a width of 19.3 ft. Show all of your work. (4) NH3+02- NO+H2Obalance the equation Find the slope intercept equation of the line Ryan buys a baseball bat. The original price is $20. Ryan has a coupon for a 20% discount. What is the sale price? Which can provide the most energy in an ecosystem?a mushroom ,a coyote, a pine tree ,a grassy meadow Please HELP what is the slope-intercept equation slope: -2 y-intercept: 3 Please help me with this question please!!!Look at the picture provided and answer the question >>Select one only.Q:An aromatic hydrocarbon is represented by which structural formula?>>Choose one answer from the picture below that answers the question above ABCD Angel and his 2 sisters shared 1/2 cup of baby carrots. How many cups did they each get? How does biology affect behavior? tell whether each question is true or false.a. [tex] \sqrt[3]{60} = 20 \: true \: or \: false[/tex]b.[tex] \sqrt[3]{64} = \sqrt{16 \:} true \: or \: false[/tex]c. [tex]25 = \sqrt[3]{125} \: true \: or \: false[/tex]d.[tex]12 = \sqrt[]{144} \: true \: or \: false[/tex]e.[tex] \sqrt{ \frac{4}{9} } = \sqrt[ 3]{ \frac{8}{27} } \: true \: or \: false[/tex] If a wagon train traveled 12.5 miles each day, how many days would it takethem to get to Independence Rock which is 900 miles from their startingpoint? Find the value of c x 8 when c=9. Can someone find the mistakes and make the sentence plz.On both plz :( Which sentence uses parallel structure correctly?A) We plan on playing basketball and then to see a movie.B) She is not only a good cook but also she figure skates well.C) At the last performance, we were all feeling sad, relieved, and being somewhat nervous.D) Len's favorite pastimes are listening to music, going to baseball games, and hanging out with his friends.