9. Which of these is not a mixture? *
Solution
Alloy
Amalgam
They are all mixtures.

Answers

Answer 1

Answer:

They are all mixture

Explanation:

last option


Related Questions

Which chemical equations show a precipitation reaction?

Select all the correct answers.

2NaNO3(aq) + NiCl2(aq) → 2NaCl(aq) + Ni(NO3)2(aq)
MgSO4(aq) + CaCl2(aq) → MgCl2(aq) + CaSO4(s)
AlBr3(aq) + 3LiI(aq) → AlI3(aq) + 3LiBr(aq)
FeCl2(aq) + Na2CO3(aq) → FeCO3(s) + 2NaCl(aq)
2AgNO3(aq) + Na2S(aq) → Ag2S(s) + 2NaNO3(aq)

Answers

The equations that show a precipitation reaction would be [tex]MgSO_4(aq) + CaCl_2(aq) --- > MgCl_2(aq) + CaSO_4(s)[/tex], [tex]FeCl_2(aq) + Na_2CO_3(aq) --- > FeCO_3(s) + 2NaCl(aq)[/tex], and [tex]2AgNO_3(aq) + Na_2S(aq) --- > Ag_2S(s) + 2NaNO_3(aq)[/tex]

What is a precipitation reaction?

It is a reaction in which two soluble salts react in aqueous solutions to form one soluble and one insoluble salt.

Thus, all the equations with an insoluble salt as one of the products will qualify as precipitation reactions. The insoluble is designated as (s).

Hence, the following are precipitation reactions:

[tex]MgSO_4(aq) + CaCl_2(aq) --- > MgCl_2(aq) + CaSO_4(s)[/tex][tex]2AgNO_3(aq) + Na_2S(aq) --- > Ag_2S(s) + 2NaNO_3(aq)[/tex][tex]FeCl_2(aq) + Na_2CO_3(aq) --- > FeCO_3(s) + 2NaCl(aq)[/tex]

More on precipitation reactions can be found here: https://brainly.com/question/24158764

#SPJ2

What is the name for C2I3

Answers

Answer: The correct name for the compound [tex]C_2I_3[/tex]  is, Dicarbon triiodide.

Explanation:

[tex]C_2I_3[/tex] is a covalent compound because in this compound the sharing of electrons takes place between carbon and iodine.. Both the elements are non-metals. Hence, it will form covalent bond.

The naming of covalent compound is given by:

The less electronegative element is written first.

The more electronegative element is written second. Then a suffix is added with it. The suffix added is '-ide'.

If atoms of an element is greater than 1, then prefixes are added which are 'mono' for 1 atom, 'di' for 2 atoms, 'tri' for 3 atoms and so on.

Hence, the correct name for the compound [tex]C_2I_3[/tex]  is, Dicarbon triiodide..

What is the standard reduction potential, E, for the half-reaction Al(aq) +
3e→ Al(s)?
OA. -0.76 V
OB. -1.68 V
Oc. 2.37 V
OD. 2.71 V
SUBMIT

Answers

The standard reduction potential for the given question is-1.68 V, under the condition that the given half-reaction is  Al(aq) +3e→ Al(s), then the required answer to the given question is Option B.

The standard reduction potential refers to the potential difference comparing the standard hydrogen electrode (SHE) and the half-reaction. The (SHE) possess a standard reduction potential of 0 V at all temperatures.

Hence, the standard reduction potential for the half-reaction Al(aq) + 3e→ Al(s) can be evaluated as follows

E°(Al₃⁺(aq) + 3e⁻ → Al(s)) - E°(H⁺(aq) + e⁻ → 1/2H₂(g))

= -1.66 V - 0 V

= -1.66 V

≈ -1.68 V

A half-reaction can occur for either the oxidation or reduction reaction component of a redox reaction. It projects the change in oxidation states of the substances involved. Half-reactions are applied to describe the processes in an electrochemical cell, in which one metal is oxidized at the anode and another metal is reduced at the cathode.

To learn more about half-reaction

https://brainly.com/question/26411933

#SPJ1

Answer:

B

Explanation:

-1.68 V

How can you tell S-wave arrival from the end of the P-wave?

Answers

Answer:

The P wave will be the first wiggle that is bigger than the rest of the little ones (the microseisms). Because P waves are the fastest seismic waves, they will usually be the first ones that your seismograph records. The next set of seismic waves on your seismogram will be the S waves

How many moles are 5.55 x 104 atoms of Mg?

Answers

Answer:

23 atoms. I hope this helped u

Explanation:

Enzymes are catalysts in reactions. What statements describe functions of enzymes?

a. Enzymes are specific in their actions.
b. Once an enzyme binds to a substrate, it cannot be used again.
c. Enzymes lower the energy of activation needed for a reaction
d. Enzymes change the amount of free energy produced
e. Enzyme activity can be affected by temperature.

Answers

Answer:

a. Enzymes are specific in their actions.

c. Enzymes lower the energy of activation needed for a reaction

e. Enzyme activity can be affected by temperature.

Explanation:

Enzymes are proteinous structures that acts as biological catalysts in chemical reactions that occur within a system. Like every other catalyst, which speedens the rate of chemical reactions, enzymes possess certain characteristics that makes them have the catalytic nature. They include:

- Enzymes are specific in their actions: Enzymes are substrate-specific, meaning that an enzyme can only act on a substrate it recognizes and binds to.

- Enzymes lower the energy of activation needed for a reaction: Enzymes like other catalyst speed up the rate at which a reaction occurs by lowering the activation energy needed for the reaction to take place.

- Enzyme activity can be affected by temperature: Since enzymes are proteinous i.e made of proteins, they can be easily denatured by temperature. Hence, when exposed to high temperature, enzymes can lose its shape and ultimately its function.

a. Enzymes are specific in their actions.

c. Enzymes lower the energy of activation needed for a reaction

e. Enzyme activity can be affected by temperature.

What are Enzymes?  

Enzymes are structures that acts as biological catalysts in chemical reactions that occur within a system. Like every other catalyst, which increases the rate of chemical reactions, enzymes possess certain characteristics that makes them have the catalytic nature. They include:

- Enzymes are specific in their actions: Enzymes are substrate-specific, meaning that an enzyme can only act on a substrate it recognizes and binds to.

- Enzymes lower the energy of activation needed for a reaction: Enzymes like other catalyst speed up the rate at which a reaction occurs by lowering the activation energy needed for the reaction to take place.

- Enzyme activity can be affected by temperature: As enzymes are proteinous i.e. made of proteins, they can be easily denatured by temperature. Hence, when exposed to high temperature, enzymes can lose its shape and ultimately its function.

Therefore, option a, c and e are correct.

Learn more:

brainly.com/question/13981863

2
What is the difference between weight and mass?
A Weight depends on density and mass depends on gravity.
B Weight depends on gravity and mass depends on volume.
C
Mass depends on gravity and weight is constant.
D Welght depends on gravity and mass is constant.

Answers

Answer:

Weight is the measure of the force of gravity on an object. The mass of an object will never change, but the weight of an item can change based on its location. For example, you may weigh 100 pounds on Earth, but in outer space you would be weightless.

Explanation:

I can't see the options but I hope this helps!

Answer:

the answer is B.

I hope this helps!

Explanation:

Plsss name this compound ​

Answers

Explanation:

It looks like 2,2,4-trimethylpentane.

Longest alkane chain contains 5 carbons. => -pentane

3 methyl groups on the 2nd, 2nd and 4th carbons.

What element corresponds to period 5, group 2

Answers

Answer:

Strontium is the second element placed in the 5th period

Hope this will help you if not so advance sorry :)

the earth's crust is part of which sphere?​

Answers

Answer:

Lithosphere

Explanation:

The lithosphere is the solid, outer part of the Earth. The lithosphere includes the brittle upper portion of the mantle and the crust, the outermost layers of Earth's structure. It is bounded by the atmosphere above and the asthenosphere (another part of the upper mantle) below.

MARK ME AS BRAINLIEST PLS

Which feature does an iron metal have?

Answers

a feature that an iron metal has is a sea of electrons

Compare the orbital notations of the substances investigated in this experiment with their attraction to the magnet. What unique feature in the orbital notation could be used to predict an attraction to a magnet

Answers

Answer:

Number of unpaired electrons

Explanation:

We know that for the compounds listed, the nature of the electrons in the d orbitals affects their interaction with an applied magnetic field.

If there are unpaired d electrons present, the compound is paramagnetic and is more strongly attracted to a magnetic field.

Similarly, if there are paired d electrons, the compound is diamagnetic and is less strongly attracted to a magnetic field.

if 3.26 g is dissolved in enough water to make exactly 323 ml of solution, what is the molar cocentration of nitrate ion g

Answers

Divide both sides to get 104 and that’s your answer

A 275 g sample of a metal requires 10.75 kJ to change its temperature from 21.2 oC to its melting temperature, 327.5 oC. What is the specific heat of this metal

Answers

Answer:

[tex]c=0.127\ J/g^{\circ} C[/tex]

Explanation:

Given that,

Mass of the sample, m = 275 g

It required 10.75 kJ of heat to change its temperature from 21.2 °C to its melting temperature, 327.5 °C.

We need to find the specific heat of the metal. The heat required by a metal sample is given by :

[tex]Q=mc\Delta T[/tex]

c is specific heat of the metal

[tex]c=\dfrac{Q}{m\Delta T}\\\\c=\dfrac{10.75\times 10^3\ J}{275\times (327.5 -21.2)}\\\\=0.127\ J/g^{\circ} C[/tex]

So, the specific heat of metal is [tex]0.127\ J/g^{\circ} C[/tex].

How many atoms are in 1 mole of water, H2O?

Answers

Answer:

1.807×10and at the top of ten put -24

How is gravity a driving force in both weathering and erosion

Answers

Answer:

Gravity is another force that contributes to erosion, especially when combined with slope. Gravity pulls rocks and boulders down mountainsides and chunks of ice down glaciers. Gravitational pull also helps move water laden with dirt and weathered materials to low-lying areas.

Explanation:

write the neutralization equations that take place in the stomach with the bases present in the antacid product

Answers

Answer:

See explanation.

Explanation:

Hello!

In this case, since the antacid is usually composed by the following bases:

- Calcium, magnesium and aluminum hydroxides.

- Hydrogen sodium carbonate.

- Sodium carbonate.

In such a way, the feasible reactions that undergo when they react with the stomach acid are shown on the attached picture. As you can see, they all have in common the formation of chlorides and water, which are the neutralization products that calm down the acidity as they are neutral.

Best regards!

A sample of gas has a density of 0.53 g/L at 225 K and under a pressure of 108.8 kPa. Find the density of the gas at 345 K under a pressure of 68.3 kPa. Assuming the mass is equal to 1 gram.

Answers

Answer:

[tex]\rho _2=0.22g/L[/tex]

Explanation:

Hello!

In this case, since we are considering an gas, which can be considered as idea, we can write the ideal gas equation in order to write it in terms of density rather than moles and volume:

[tex]PV=nRT\\\\PV=\frac{m}{MM} RT\\\\P*MM=\frac{m}{V} RT\\\\P*MM=\rho RT[/tex]

Whereas MM is the molar mass of the gas. Now, since we can identify the initial and final states, we can cancel out R and MM since they remain the same:

[tex]\frac{P_1*MM}{P_2*MM} =\frac{\rho _1RT_1}{\rho _2RT_2} \\\\\frac{P_1}{P_2} =\frac{\rho _1T_1}{\rho _2T_2}[/tex]

It means we can compute the final density as shown below:

[tex]\rho _2=\frac{\rho _1T_1P_2}{P_1T_2}[/tex]

Now, we plug in to obtain:

[tex]\rho _2=\frac{0.53g/L*225K*68.3kPa}{345K*108.8kPa}\\\\\rho _2=0.22g/L[/tex]

Regards!

What is this element?

Answers

Explanation:

sodium element with 11 electrons,11protons and 12 neutrons

a pure sample of an unknown molecule has a mass of 0.03551 kg and contains 0.2000 moles wbat is the molecular weight of the substance

Answers

Answer:

No

Why?

Explanation:

A pure sample of an unknown molecule has a mass of 0.03551 kg and contains 0.2000 moles.

What is the molecular weight of the substance?

Answer:

177.6 g/mol

Explanation:

Trust me

in a pond food chain that includes tadpoles, algae, turtles, dragonflies, and frogs, which one is the primary consumer

Answers

Answer:

turtles

Explanation:

Turtles eat frogs and no animal in the pond can consume a turtle

i need help

can anyone help me

Answers

the answers are on the picture

A light bulb consumes energy at a rate of 80

joules per second . How long in

seconds will it take for the light bulb to consume 2.30 ~ 105

in energy?

Answers

Answer:

2875 s

Explanation:

From the question given above, the following data were obtained:

Power (P) = 80 J/s

Energy (E) = 2.3×10⁵ J

Time (t) = ?

Power can simply be defined as the rate at which energy is used. Mathematically, power is expressed as:

Power = Energy / time

P = E/t

With the above formula, we can obtain the time taken for the bulb to consume 2.3×10⁵ J. This can be obtained as follow:

Power (P) = 80 J/s

Energy (E) = 2.3×10⁵ J

Time (t) = ?

Power = Energy / time

P = E/t

80 = 2.3×10⁵ /t

Cross multiply

80 × t = 2.3×10⁵

Divide both side by 80

t = 2.3×10⁵ / 80

t = 2875 s

Therefore, it will take 2875 s for the bulb to consume 2.3×10⁵ J of energy.

what are van allen belts?

Answers

Answer:

A Van Allen radiation belt is a zone of energetic charged particles, most of which originate from the solar wind, that are captured by and held around a planet by that planet's magnetic field. Earth has two such belts, and sometimes others may be temporarily created

Explanation:

CHEMISTRY HELP
Once the following equation is balanced, what is the correct coefficient for Z₂?

Answers

Answer:

The coefficient of Z₂ is 1.

Explanation:

From the question given above:

X + ZY —> XY + Z₂

Next, we shall balance the equation to obtain the coefficient of Z₂. This can be obtained as follow:

X + ZY —> XY + Z₂

There is 1 atom of Z on the left side and 2 atoms on the right side. It can be balance by putting 2 in front of ZY as shown below:

X + 2ZY —> XY + Z₂

There are 2 atoms of Y on the left side and 1 atom on the right side. It can be balance by putting 2 in front of XY as shown below:

X + 2ZY —> 2XY + Z₂

Now, we have 1 atom of X on the left side and 2 atoms on the right side. It can be balance by putting 2 in front of X as shown below:

2X + 2ZY —> 2XY + Z₂

Now the equation is balanced.

Thus, the coefficient of Z₂ is 1.

When all the colors of the spectrum are combined, what will the human
eye see?
A black
B. blue
C. red
D. white

Answers

Answer: white?

Explanation:

When all the colors of the spectrum are combined and strike the human eye at the same time, the human eye will see white color. Therefore, option (D) is correct.

What is the electromagnetic spectrum?

The electromagnetic spectrum can be described as the range of frequencies of electromagnetic radiation and its wavelengths and photon energies. The electromagnetic spectrum have range from below one hertz to above 10²⁵ hertz.

Electromagnetic radiation with a wavelength between 380 to 760 nm is detected by the human eye and recognized as visible light. Other wavelengths, especially near-infrared and ultraviolet are also sometimes referred to as light.

White light can be defined as a combination of lights of different wavelengths in the visible region of the spectrum. When white light is passed through a prism splits it up into the several colors of light observed in the visible spectrum.

Therefore,  all the colors of the spectrum are combined, and the human eye will see white color.

Learn more about electromagnetic spectrum, here:

https://brainly.com/question/15576247

#SPJ6

Number of atoms in 4.5 moles of Au?

Answers

Don’t have a calculator on me but multiply 6.02x10 to the 23rd power by 4.5

bill nye chemical reactions:

the picture looks cut off but can someone please help!

Answers

Answer:

. A(n) _______________________________ is matter that is composed of 2 or more different kinds of atoms.

2. A chemical reaction in which energy is released/given off is _____________________________________.

3. A(n) _________________________________ is a process in which substances are changed into other

substances.

4. Matter that is composed of only 1 kind of atom is a(n) ______________________________.

5. ___________________ is the ability to do work and/or transfer heat.

6. A chemical reaction in which energy is absorbed/taken in is _______________________________.

Knew/New

Write down 3 things you already knew about chemical reactions that were confirmed through watching the

video:

1.

2.

3.

Write down 3 new things that you learned from watching the video:

1.

2.

3.

Episode Guide

1. Chemicals can react to form new _________________________________.

2. Chemical reactions happen when ____________________ hook together.

3. Energy is given off during a chemical reaction because ____________________ are combining with other

__________________________.

4. During the "Try this" experiment, we see the students using vinegar and salt to clean old copper pennies.

The copper gets stripped away and the pennies look new again. Explain why you think this happens.

__________________________________________________________________________________________

Answer Key

compound

exothermic

chemical reaction

element

Energy

endothermic

Answers will vary.

Answers will vary.

chemicals

electrons

electrons

electrons

Copper atoms in the penny react with oxygen atoms from the air & together they form copper oxide which

makes the pennies look dull and dirty. The copper oxide dissolves in a weak acid (the vinegar & salt).

5. When vinegar and baking soda react together, the new substance that is produced is ___________________.

6. _______________ & ______________ are both dangerous by themselves, but when they react together they

form table salt.

7. Pyrotechnician is a name given to people who work to create _________________________.

8. In another experiment, we see kids blow up a balloon by mixing together vinegar and baking soda. When

the kids touch the blown up balloon, it is ____________ to the touch. This means that the reaction is

endothermic or exothermic

9. When someone gets hurt playing sports, often times a cold pack is used for the injury. The cold pack takes

up more energy than it gives off and it gets very ___________ to the touch. This means that the reaction taking

place is endothermic or exothermic

10. How do you know baking a cake is a chemical reaction? ________________________________________

11. There are ___________ naturally occurring elements.

12. If elements are in the same group on the periodic table, what does that tell you? ______________________

__________________________________________________________________________________________

True or False

1. When something burns, heat & light are given off. T or F

2. Your stomach growling is an example of a chemical reaction. T or F

3. Water is 1 part hydrogen and 2 parts oxygen. T or F

4. When baking a cake, a chemical reaction takes place. T or F

5. Everything is made of chemicals. T or F

6. Alfred Nobel invented dynamite. T or F

7. You should always wear safety goggles when working with chemicals. T or F

8. Sodium chloride is better known as sugar. T or F

9. A substance can feel a little warm if the reaction is endothermic. T or F

10. When developing film, red light doesn't affect the picture. T or F

11. A cold pack gets cold because the reaction takes more energy than it gives off. T or F

12. If chemicals behave similarly, they are grouped together on the periodic table. T or F

13. Chemical reactions happen when protons link atoms together. T or F

14. When vinegar and baking soda react, oxygen is produced. T or F

15. Fireworks are not an example of chemical reactions. T or F

carbon dioxide

Sodium chlorine

fireworks

warm

cold

The ingredients (flour, milk, eggs, etc.) are changed

Explanation:

please help..............

Answers

rgrgtff

ghhbbbhhghghgghgggferer

What are the complete Ionic and Net Ionic equations for the following

a) CaCl2(aq) + Pb(NO3)2(aq) → PbCl2(s) + Ca(NO3)2(aq)

b) CaCl2(aq) + Na2CO3(aq) → CaCO3(s) + 2NaCl2(aq)

c) 2AgNO3 (aq) + BaI2(aq) → Ba(NO3)2 (aq) + 2AgI (s)

Answers

Answer:

Check photo

Explanation:

Other Questions
who is a better band1:One direction2: 5 seconds of summer 3: BTS4:Little mix5: other Which of the following describes hetereogeneous mixture... 1)A mixture that is easily separated, the components are different sixes and unevenly mixed. 2) A mixture that is very difficult to separate, the contents are evenly mixed and the mixture looks like a substance Light rays from the sun are called: solar energy heat energy chemical energy a circle has a center at (-2,7). if a point on the circle has coordinates (3,-1) then which of the following would be the length of the radius of the circle write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC if you answer some of them ill appreciate it ( you don't have to answer all of them ) What can cause a significant change in someones life Which value is in the domain of f(x)?f(x) = StartLayout Enlarged left-brace 1st row 1st column 2 x + 5, 2nd column negative 6 less-than x less-than-or-equal-to 0 2nd row 1st column negative 2 x + 3, 2nd column 0 less-than x less-than-or-equal to 47645 How is the idea of freedom presented in Martin luther kings speech? Explain what is meant by "majority opinion".Your answers Lieutenant Patrick O'Bannon defeated the Pasha of Tripoli at ___.ItalyWeehawkenEgyptNew OrleansDerna Explain the role that King George III played during the American Revolution. WILL MARK BRAINLIEST:> IF YOU ARE LUCKY pick a number from 1 to 20 CLOSEEST NUMBER TO THE NUMBER I PICK WILL BE THE BRAINLIEST GOOD LUCK How do you make someone brainliest In the 1800s, unmarried women hadmore rights than married women.the same rights as married women.fewer rights than married women.no rights, just like married women. List and explain the major features that the following building designs must have to relate directly to their functions.-Hospital-Airport-Courthouse A student observes a difference in the activity level of fish at a pet store. The fish in an aquarium near the window are swimming around more quickly tha the fish in an aquarium placed in the back of the store. The student forms a hypothesis about the effect of sunlight on fish activity levels and arranges to conduct an experiment. Which variable could be an independent variable in the student's experiment? types of fish sold speed of swimming fish amount of time fish were active temperature of water in fish tank how do you do this equation ?solving inequalities 8 2x < x + 7 Need help with this math problem Bacteria reproduce in a process called binary fission which of the following is true about binary fission?