5.3. He left in a hurry after he got a phone call
, but
he came back five minutes later.
(2 Points)
simple
compound
complex
compound-complex

5.3. He Left In A Hurry After He Got A Phone Call, Buthe Came Back Five Minutes Later.(2 Points)simplecompoundcomplexcompound-complex

Answers

Answer 1
Compound sentence is the answer
Answer 2

The sentence "He left in a hurry after he got a phone call, but he came back five minutes later" is a compound-complex sentence.

A compound-complex sentence has, at least, two independent clauses and one dependent clause.

An independent clause has a subject and a predicate. It conveys a full thought and can stand alone as a sentence.

One of the two independent clauses in a compound-complex sentence will be introduced by a coordinating conjunction - but, for, and, nor, or, yet, so.

A dependent clause is introduced by a subordinating conjunction - after, because, etc.. It also has a subject and a predicate, but it cannot stand alone as a sentence.

We can break down the sentence we are analyzing here in the following manner:

1. Independent clause: "He left in a hurry"

2. Dependent clause: "after he got a phone call"

3. Independent clause: "but he came back five minutes later."

Learn more about the topic here:

https://brainly.com/question/9405721


Related Questions

"Metonymy" is best defined as a figure of speech in which ______.​

Answers

Answer:

Metonymy is best defined as a figure of speech in which one noun is substituted for another with which it is closely associated. Personification would be human characteristics that are attributed to objects or animals. Hyperbole would be exaggeration used for emphasis.

hope it helps! please mark me brainliest..

thank you!! have a good day ahead

Answer:

got from a old brainly question

Metonymy is best defined as a figure of speech in which one noun is substituted for another with which it is closely associated.

Personification would be human characteristics that are attributed to objects or animals.

Hyperbole would be exaggeration used for emphasis.

Synecdoche would be a part of something that stands for the whole.

Explanation:

The president and vice president are formally chosen when members of the​

Answers

Answer:

Electoral college collect the votes from each state's representatives

Explanation:

(I hope this is right you didn't really explain it much)

HELP I NEED ANSWERS QUICK RIGHT ANSWER GETS BRAINLIEST!!! In "Mary Cassatt: Artist and Trailblazer," how does Vanessa Wright convey her viewpoint that Cassatt cared more about her art than popularity and wealth?

Wright states that Cassatt developed her own style of painting.

Wright describes how Cassatt left the Salon to paint with Degas' group.

Wright explains how Cassatt was the only American artist to exhibit with the Impressionists.

Wright describes Cassatt's reaction when she first saw Degas' art.

Answers

Answer:

It is B! I took the quiz and told me that was the answer.

Explanation:

Answer:

the answer is B

Explanation:

i took the quiz i got it wrong and it said that that was the answer

PLEASE HELP! ASAP!
How is D'Artagnan saved from being arrested by the Cardinal?

Answers

Answer:

D'Artagan saves himself by presenting a letter of protection that he took from Milady. ... Aramis says he is entering a monastery and D'Artagnan must take his place in the musketeers. d. D'Artagnan jumps out the window and escapes to England.

Explanation:

Which statement best explains how the two points of
view affect the reader's understanding of the text?
O The reader sees how miscommunication is
preventing understanding between the groups.
O The reader realizes that both the soldiers and the
Cherokee men are respectful to the women.
O The reader sees that the Cherokee are brutalized
and the soldiers dehumanize them.
O The reader realizes that neither the soldiers nor the
Cherokee suffer during the removal.
of
ear,
ncy

Answers

Answer: C The reader sees that the Cherokee are brutalized and the solders dehumanize them.

Explanation:

please help me please will give brainliest


short summary ​

Answers

Summary:

The clock ticked on, repeating and repeating its sounds into the emptiness. And the rain tapped on the empty house, echoing. At eight-thirty the eggs were shrivelled and the toast was like stone. The five spots of paint - the man, the woman, the children, the ball- remained. It sniffed the air and scratched the kitchen door. Behind the door, the stove was making pancakes which filled the house with a rich baked odour and the scent of maple syrup. In the cellar, the incinerator glowed suddenly and a whirl ofsparks leaped up the chimney. The dinner dishes manipulated like magic tricks, and in the study a click. Dawn showed faintly in the east. Among the ruins, one wallstood alone. Within the wall, a last voice said, over and over again and again, even as the sun rose to shine upon the heaped rubble and steam: "Today is August 5, 2026, today is August 5, 2026, today is..."

BRAINLIST PLS!

One day while walking home from school, he found a magic blanket. When he covered himself with it, he turned invisible. At first he used his power to play all kinds of tricks on people. He would turn invisible and hide things, or move a cup when someone was pouring juice to make a mess. He had a lot of fun. But then one day, he found that he couldn’t take the blanket off. He was just stuck being invisible. Meanwhile, he quit playing tricks on people, hoping that he’d be able to take the blanket off and rejoin society, but it didn’t work. He is still invisible somewhere right now, and he is very lonely.

Compare/ Contrast


Chronological


Cause/ Effect


Problem/ Solution


Enumeration/ Description

Answers

You should post this question again and try to get more answers I would choose chronological because the others don’t seem to fit but im not 100%

Select an antonym for the word true

dublous

assured

real

valid​

Answers

Answer:

dubious

Explanation:

Dublous because the others would be synonyms.

plzs help

What is pictured? Would you consider it art? Why or why not?

Answers

Answer:

Yes, it can be considered art.

Explanation:

As long as it was designed with the intent to show a semblance of emotion, or with a clear direction in mind, it is art.

Answer:

It is art

Explanation:

people use dancing to tell a story.just like a painting.it tells a story.

What did the Nazi's tell the prisioners they were going to do when
they took them to the gas chamber? What did they do with the bodies
after they died in the gas chamber?
I

Answers

They told them they were going to shower

Burned the bodies

10 points ENGLISH HELP PLZ GIVING BRAINIST

Select the correct text in the passage. Read the excerpt from "The Story of the Old Man Who Made Withered Trees to Flower" by Yei Theodora Ozaki. Which sentence reveals the theme of companionship? The happiest hour of the day both for the old man and his dog was when the man returned from his work in the field, and having finished his frugal supper of rice and vegetables, would take what he had saved from the meal out to the little veranda that ran round the cottage. Sure enough, Shiro was waiting for his master and the evening tid-bit. Then the old man said “Chin, chin!” and Shiro sat up and begged, and his master gave him the food. Next door to this good old couple there lived another old man and his wife who were both wicked and cruel, and who hated their good neighbors and the dog Shiro with all their might. Whenever Shiro happened to look into their kitchen they at once kicked him or threw something at him, sometimes even wounding him. One day Shiro was heard barking for a long time in the field at the back of his master’s house. The old man, thinking that perhaps some birds were attacking the corn, hurried out to see what was the matter. As soon as Shiro saw his master he ran to meet him, wagging his tail, and, seizing the end of his kimono, dragged him under a large yenoki tree. Here he began to dig very industriously with his paws, yelping with joy all the time. The old man, unable to understand what it all meant, stood looking on in bewilderment. But Shiro went on barking and digging with all his might.

Answers

Answer: The happiest hour of the day both for the old man and his dog was when the man returned from his work in the field, or Sure enough, Shiro was waiting for his master and the evening tid-bit. Then the old man said “Chin, chin!” and Shiro sat up and begged, and his master gave him the food.

Explanation:

Answer:

give her brainleist

Explanation:

make sentence on gung hone in marathi​

Answers

Answer:Marathi translation of 'गुंग होणे'. मराठी Marathi meaning of 'गुंग होणे'. become = गुंग होणे | guNg honneget absorbed.

Explanation:

What causes a conflict in the story? Button, Button

Answers

Answer:

i just searched it ...

Explanation:

Conflict. The conflict in the story was when Norma and Arthur are fighting over the button. Norma believes that getting the money is nessicery. But Arthur thinks that it's murder and he will never do it, he is not even thinking about it.

Answer:

The conflict in the story was when Norma and Arthur are fighting over the button. Norma believes that getting the money is nessicery. But Arthur thinks that it's murder and he will never do it, he is not even thinking about it.

Select from the drop-down menu the pronoun that best completes the sentence. Henry met _____ on a hiking trip.
A.he
B.her
C.she
D.their

Answers

Answer:

her

Explanation:

The answer would be Her

Write an informational paragraph about the Great Wall of China (100 points)

Answers

Answer:

The Great Wall of China is the top ten new wonders of the world 2012. Located in China it stretches from Shanhaiguan in the east, to Lop Lake in the west. The entire wall is about 21,000 km long. The main part of the wall is 2,500 miles long and stretches through all sorts of mountains. The wall is thirty feet high and twenty-five feet thick at its base.

The Huns and barbarians had no farming land and they used to entre china and killed and invade the people for food and wealth. The wall was constructed to protect China and its people from Huns and barbarians and also restrict the entry of invaders coming from the Silk Road.

“There in the mist, enormous, majestic, silent and terrible, stood the Great Wall of China. Solitarily, with the indifference of nature herself, it crept up the mountain side and slipped down to the depth of the valley.” – W. Somerset Maugham

The construction of the wall started during the Qin dynasty at 221 BC. The emperor Qin Shih Huang aimed at protecting china from invaders who regularly attacked Chinese farming villages. The Great wall surrounded the central part of China, which was the most important part of China.

It took more than hundred years in completing The Great Wall. The wall started deteriorating with the passage of time because of natural disasters, strong winds dusts and storms. It was constructed again in the 15th century by Emperor Meng Tien.

Explanation:

During his speech, old major addressed the animal as

Answers

Answer:

Comrades

Explanation:

According to the book Animal Farm by George Orwell, Old Major addressed the animals during his speech as "comrades".

He has considerable influence among the animals and they listen to him with rapt attention.

Old Major calls them comrades in order to form a spirit of togetherness with them and convey to them that they were all equal and no one was more important than the other.

Answer:                              

its comrades

I have to do a book report but I dont know what to do so please help and if u did thanks
1. State the title of the book
2. How many pages
3. 120 characters at least of the summary of the book​

Answers

Answer:

I decided to do a book report about The Hunger Games  by Suzanne Collins. It came out back in 2008, yet I only read it this past school year. It was a lovely discovery. I have not been able to find any recent books that I am interested in enough to read. But reading The Hunger Games caught my full attention and interested me greatly. It is a dystopian future themed book packed full of adventure and politics. It’s main character is a girl named Katniss Everdeen. She is one of my favorite female leads in any book I’ve read. She’s a very independent and pessimistic character, both of which are not commonly seen traits in female leads. She took care of her family from a young age after her father died. She had a hard life growing up which has led her to not trusting people very easily or being very optimistic about life.I found it very easy to get interested in this book.

It drew me in with various symbolic meanings and political themes. I find the setting of the book to very closely relate towards how the American government is heading. People with money will have all of the power and the poor will be left no choice but to obey their every command. The people of the Capitol know that they have the power and they use it to their advantage. Power hungry politicians have the same mindsets. They don’t care whose life gets ruined as long as they get what they want in the end. The Capitol people pretend to care about the people of the districts, but they don’t.

There is a wide spectrum of character types to help represent each district. This helps paint a picture to the readers of what life is like in each district. I dislike when a book is solely based on developing romance. The Hunger Games is a breath of fresh air with little to no romance. Romance in the book is almost like an afterthought, but even when it comes into the book it is not a huge part of the book and is even a little faked. I’m not a big fan of books only based over romance, but The Hunger Games does a great job of not focusing on romance and mainly focusing on the plot and character development. Overall I really like this book, once I started I couldn’t put it down. It is a book that will draw readers in and immerse them into the universe that they are reading about. I would highly suggest reading this book and a special thanks to _____( WHOEVER YOU WANT)___ for introducing this book to me.

Q.Ankit said to Rita, " It is your last chance." 1.Ankit said Rita it is your last chance. 2.Ankit told Rita that it is her last chance. 3.Ankit told Rita that it was her last chance. 4.Ankit told Rita that it was their last chance.

Answers

Answer:

The correct option is:

3. Ankit told Rita that it was her last chance.

Explanation:

This question is about reported speech. When we report what someone has said, it is important to observe a few things.

1. We usually change the verb tense to the past form of the tense used in the original sentence. In this case, the simple present was used. Therefore, the reported version will be in the simple past.

2. The pronouns need to change accordingly. When Ankit said "your", he was talking to Rita. Now that we are reporting what he said, since we are not talking directly to Rita, we should change "your" to "her".

Having that in mind, we can safely make the changes:

Ankit said to Rita, "It is your last chance." - 3. Ankit told Rita that it was her last chance.

5.18 Unit Test: On the Outside Looking In - Part 2 Pool 1
Question 1 (25 points)
Read the prompt, and type your response in the space provided.

This unit focuses on those who feel they are on the outside looking in. Compare and contrast how this idea is developed in Mowgli's Brothers from The Jungle Book and All Summer in a Day. Use textual evidence to support your response.

Question 1 options:

Answers

Answer and Explanation:

Being outside can have two different meanings. Both fit the two stories shown in the question above. One of these meanings is that a person who is outside a system, looking from the inside, has a panoramic view of the entire system and can gain advantages in trying to operate it because of his superior knowledge. This meaning can be compared with the story presented in "Mowgli's Brothers" where Mowgli through the cognitive capacity that humans have is able to understand the behavior of wolves and reproduce them, being considered a worthy member of the pack.

Another meaning is that which says that a person who is outside observing the internal part of a system, may be experiencing social exclusion, where it is not accepted and undergoes hostility by a marjoritary group. This meaning can be applied in "All Summer in a Day" where a girl is excluded, harassed and rejected by other children, because she is the only one who really knows the sun.

The comparison and contrast about how this idea is developed in Mowgli's Brothers from The Jungle Book and All Summer in a Day is:

The person who is outside has a clearer view, just like Mowgli who has a panoramic view and can make better decisions.It also shows that an outsider is excluded from a group.

Based on the complete text, we can see that there is the narration about Mowgli where he is excluded from the pack and this outside view gives him the needed angle to see the behavior of the pack.

However, this also shows that he was excluded and this shows that the pack does not trust him which makes him to do certain things to win their trust.

Read more about Mowgli here:

https://brainly.com/question/898371

I was stunned. A call-up: everyone knows what that means. Visions of concentration camps and lonely cells raced through my head. How could we let Father go to such a fate?

Which word best describes the mood of this excerpt?

isolation
fear
anger
confusion

Answers

Answer:

fear

Explanation:

The narrator of the text shown above, presents terrible and frightening visions in relation to the word "call-up", which instantly makes the narrator think about the terrors that happen in the concentration camps and fears that her father will end up in this place of suffering. , terror and death.

This shows us that the narrator is afraid and that is the mood she wants to pass on to the reader.

Answer:

the answer would be B

Explanation:

The costs of survival summary

Answers

Explanation:

write in what states and which it points

Answer:In 2012, millions of people hiked, climbed, and boated in national parks, but only 2,876 needed help. Only 1,627 of these emergencies may have been caused by risky decisions. Even so, someone has to pay for those rescues. The rescue of the family stranded at sea cost $663,000.

Explanation: hope it helps

The following question has two parts. Answer Part A first, and

then Part B.




Part A Which answer choice describes Gore’s main reason for writing his

Nobel speech?


Question 1 options:


to convince people to act



to describe scientific facts



to demand a political treaty



to thank the prize committee


Question 2 (2 points)

Part B Which sentence from the Nobel speech best supports the answer to

Part A(question 1)?


Question 2 options:


Seven years later, Alfred Nobel created this prize and the others that bear

his name.



The experts have told us it is not a passing affliction that will heal by itself.



We are what is wrong, and we must make it right.



The very web of life on which we depend is being ripped and frayed.


Question 3 (2 points)

The following question has two parts. Answer Part A first, and

then Part B.


Part A In his Nobel speech, what is Gore’s attitude regarding the progress

made to reduce global warming?


Question 3 options:


distrustful but forgiving



concerned but positive



pleased but confused



interested but lazy


Question 4 (2 points)

Part B Which sentence from the speech best supports the answer to Part A?


Question 4 options:


We, the human species, are confronting a planetary emergency—a threat





to the survival of our civilization that is gathering ominous and destructive

potential even as we gather here.

I WILL GIVE BRAINLIST IF YALL GIVE ME THE RIGHT ANSWER FIRST COPY AND PASTE THE QUESTIONS

So today, we dumped another 70 million tons of global-warming pollution

into the thin shell of atmosphere surrounding our planet, as if it were an

open sewer.



We must quickly mobilize our civilization with the urgency and resolve

that has previously been seen only when nations mobilized for war.



These are the last few years of decision, but they can be the first years of a

bright and hopeful future if we do what we must.


Question 5 (2 points)

Read the following sentence from Gore’s Nobel speech.

In every land, the truth—once known—has the power to set us free.

What is most likely the point that Gore is making with this statement?


Question 5 options:


Freedom is more important than acknowledging truth.



Truth should only be shared with certain individuals.



People who become aware of the truth can change.



Every nation has a different understanding of truth.

Answers

Answer:

to convince people to act

Question 4
Bacteriophages that induce bacterial cell lysis are called
A.virulent phages or lytic
B.lysogenic phages
C.temperate phages
D.viroids

This is ecology

Answers

A.virulent phages or lytic

PLEASE HELP ITS DUE TODAY AND I DONT KOW ITS FOR 10PTSS
Making the Most of Mucus
Just the name itself will make you giggle. It's a great word that conjures visions of slime and unpleasantness. It is perhaps the most annoying part of having a cold or allergies. Mucus, however, plays a very important role in defense of our bodies and our health. In fact, it's high time mucus got a lot more respect.

First, there are some amazing facts about mucus that are worthy of respect. Humans produce about a liter of mucus every day, whether they are sick or not. Bony fish and some invertebrates (snails or slugs) also have mucus cells on the outside of their body. This external mucus creates a protective coating that prevents predators' toxins from doing harm. Humans produce mucus to protect our stomachs, our lungs, and several other systems.

We tend to not like mucus because it is a considered a symptom or sign that something is wrong. We usually only see it when we are sick, and so we tend to dislike it. According to Michael M. Johns, III, MD, however, "mucus is incredibly important for our bodies." Johns, an assistant professor at Emory University, calls mucus "the oil in the engine" of our bodies. Without mucus, our engines, or bodies, would freeze up and stop working properly.

Furthermore, mucus is not just the nasty gunk you see when you are sick. It lines the tissues in your mouth, your nose, throat, and lungs. It also is crucial in protecting your digestive system. Mucus puts a protective coating over the surfaces of these tissues, keeping them moist. Most of the time we don't notice mucus is making our lives better. It does its job quietly, making everything run smoothly, keeping our inner tissues soft and flexible enough to fight off invaders.

Occasionally, though our mucus-making membranes go into overdrive. If you eat a hot pepper, your mucus membranes in your mouth and throat start producing extra mucus to protect you. If you come into contact with pollen, you may get a runny nose and start sneezing and coughing. When these things happen, your mucus systems start making more fluids to wash away the irritating particles. Mucus also has some antibodies that increase our ability to fight off bacteria and viruses.

It's hard to appreciate what is essentially slime, but we have mucus for some very good reasons. It helps to keep us healthy and lets us know when our bodies are under attack. We would be wise to respect what our bodies do to keep us safe. So the next time you find yourself reaching for a tissue, remember mucus is your friend and ally.

Which line from the text explains people's attitude about mucus? (1 point)

a
If you eat a hot pepper, your mucus membranes in your mouth and throat start producing extra mucus to protect you.
b
Humans produce mucus to protect our stomachs, our lungs, and several other systems.
c
We tend to not like mucus because it is a considered a symptom or sign that something is wrong.
d
It does its job quietly, making everything run smoothly, keeping our inner tissues soft and flexible enough to fight off invaders.

Answers

Answer:

C

Explanation:

It's the only choice that actually expresses an opinion.  Plus, it says it directly in the text.

Hope this helps :)

The answer to this question is d I believe hope you get it right and good luck


URGENT PLEASE ANSWER
A. School uniforms are becoming popular. Don't get left behind.
O B. We should lower unemployment because doing so gives people
jobs.
C. Don't let wrongheaded fools trick you; Bigfoot is definitely real.
D. To prevent overcrowded classrooms, the school will cut sports.

Answers

The answer should be B
Yep the answer should be B

please help me!!!! (Language Arts)

Answers

Answer:

B

Explanation:

Answer:

i would say its B

Explanation:

what would you expect a book called beloved bride: the letters of stonewall jackson to his wife to be about?
a. tactics used by horse mounted cavalry
b. a collection of letters written by Stonewall Jackson to his wife
c. a biography about Stonewall Jackson
d. stonewall Jackson's service as a general in the Confederacy

Answers

Answer:

B-

Explanation:

Well it kinda says it in the title

in the poem "Names" by Elizabeth Acevedo how does xiomara feel about her name

Answers

She was born via C-section after Mami gave birth to Xavier—Xiomara's brother Twin—with no complications, and Xiomara feels like people struggle in the same way to say her name. It's pronounced “See-oh-MAH-ruh.” She no longer flinches when teachers mess it up on the first day of school.

Read the excerpt from "My Lord Bag of Rice."

At last the dreadful night was over. Day dawned beautiful and clear. The centipede was gone from the mountain.

What historical fact is reflected in this excerpt?

Hidesato brought peace to Japan by defeating a rebel force.
Hidesato was appointed a general by Japan’s emperor.
Hidesato and his forces overthrew the government of Japan.
Hidesato was given many gifts for helping the people of Japan.

Answers

Answer:

A. Hidesato brought peace to Japan by defeating a rebel force.

Explanation:

I took the test and I got it wrong because of the other answer that the other person said. You're welcome. <3 Have a good day, I love you all. mwah. c:

Answer: a

I got a 100

what does the word temporarily mean on page 1 of the passage​

Answers

the answer is " for a brief period "

Answer:

b.

Explanation:

Other Questions
The ancient Indians can boast of few significant achievements.Please select the best answer from the choices providedTF What is the area of `STR`?A. 30 square feetB. 34.5 square feetC. 57.5 square feetD. 60 square feetHere another one T^T plzzzzzzzzz help me with this question. The question is The Incas used quipus to what ????? Which of the following is one of the greatest effects of the agricultural revolution 2 2/5 multiplied by 2 multiplied by 3 1/5 pls someone plsss help meeeee There once was a ship that put to seaThe name of the ship was the Billy of TeaThe winds blew up, her bow dipped downO blow, my bully boys, blowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goShe had not been two weeks from shoreWhen down on her a right whale boreThe captain called all hands and sworeHe'd take that whale in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goBefore the boat had hit the waterThe whale's tail came up and caught herAll hands to the side, harpooned and fought herWhen she dived down lowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goNo line was cut, no whale was freedThe Captain's mind was not of greedAnd he belonged to the whaleman's creedShe took that ship in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goFor forty days, or even moreThe line went slack, then tight once moreAll boats were lost, there were only fourBut still that whale did goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goAs far as I've heard, the fight's still onThe line's not cut and the whale's not goneThe Wellerman makes his regular callTo encourage the Captain, crew, and allSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and go Please help Im stuck!!!! PLEASE HELP I NEED THE ANSWER QUICK!!! What is the Length/ value of N is 63 / 168 equivalent to 312 / 832 Which Pope wanted to liberate Jerusalem from Muslim control? A 14.0 tank contains 250 g of methane (CH4) gas at 27 atm at 298 K. Accidentally, 190 g of CO2 was added to the tank. What will be the resulting pressure of the mixture in the tank? Assume that no CH4 leaked out as the CO2 gas waa being added. Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) PLEASE HELP!! I'LL GIVE BRAINLEST!!Use the formula P = 2l + 2w. Find the perimeter of a rectangle with a length of 12.9 ft and a width of 19.3 ft. Show all of your work. (4) NH3+02- NO+H2Obalance the equation Find the slope intercept equation of the line Ryan buys a baseball bat. The original price is $20. Ryan has a coupon for a 20% discount. What is the sale price? Which can provide the most energy in an ecosystem?a mushroom ,a coyote, a pine tree ,a grassy meadow Please HELP what is the slope-intercept equation slope: -2 y-intercept: 3