(3-5i)^2
i know the answer I’m just confused on how to get to that point. Please and thank you!

Answers

Answer 1

[tex](3-5i)^2\\\\=3^2-2(3)(5i) + (5i)^2\\\\=9-30i +25i^2\\\\=9-30i +25(-1)~~~~;[i^2=-1]\\\\=9-30i-25\\\\=-16-30i[/tex]


Related Questions

round 0.006772 to 1 significant figure

Answers

Answer:

0.007

Step-by-step explanation:

0's before other numbers are non-significant. Then you just round your number.

Hope that helps

Find the 82nd term of the arithmetic sequence —8, 9, 26, ...

Answers

N+17 , every sequence goes by that

82+17 = 99

WHAT DOES AN ANIMAL BREEDER DO?????????

I LITERALLY NEED HELP ON THIS ONE!!

Some school commercial thingy.

Answers

Answer:

Breeders cross animals of the same species with desirable traits to create desirable offspring.

Step-by-step explanation:

Simplify (y²z⁴)³ and explain answer

Answers

Answer:

y^6 z^12

Step-by-step explanation:

When the bases are the same that means that the powers on the inside can be multiplied by whatever is outside.

Hope this helps :)

What is the slope of this graph?
0.3
-3
los
1
3
3
1
2 3 4 5

Answers

Answer:

A

Step-by-step explanation:

Use the formula rise/run. The rise, in this case, was 3 and the run was 1. There for it would be 3/1 which is simplified to 3.

benny uses 2/5 grams (G) of toothpaste each time he brushes his teeth. If benny buys 30-g tube, how many times will be able to brush his teeth?

Answers

Answer:

75

Step-by-step explanation:

First divide 2/5 to get 0.4. Then divide 30 by 0.4 to get the answer. A simple way to think about it is how many 0.4 grams are in 30 gram tube.

Jeremy got a haircut and paid 15% as a tip. What percent of the cost did Jeremy pay the barber, including the tip?

Answers

The percentage of the cost that Jeremy will pay including the tip paid is 115% of the cost.

Assuming the cost was $100 and Jeremy gave a 15% tip. The total he would pay is:

= 100 + tip

= 100 + (100 x 15%)

= $115

In percentage this is:

= 115/100 x 100%

= 115%

In conclusion, Jeremy would pay 115% of the tip.

Find out more at https://brainly.com/question/22444616.

Math is multi-cultural, analytical, timeless and hands-on. Provide a piece of mathematical concept, hypothesis, law, paradox, rule or theorem to prove this statement.

Answers

It should be noted that mathematics is multicultural. This implies that mathematics applies to different cultures.

Mathematics is multicultural and it's neutral from the issues of races, gender, class, etc. Also, it should be noted that mathematics is analytical.

Furthermore, mathematics is timeless and hands-on. This implies that students need to touch and feel what they're learning through a concrete experience.

Learn more about mathematics on:

https://brainly.com/question/12798024

Quien me ayuda? pls!!!

Answers

Answer:

The answer is B

Step-by-step explanation:

You need to find the derivitive of the equation and ,ultiply by B!!!

How I can answer this question, NO LINKS, if you answer correctly I will give u brainliest!

Answers

[tex]\huge \bf༆ Answer ༄[/tex]

Let's solve this using unitary method ~

[tex] \sf3 \: seconds = 63 \: meters[/tex]

[tex] \sf1\: second= 63 \div 3 \: meters[/tex]

[tex] \sf1\: second= 21 \: meters[/tex]

[tex] \sf5\: seconds= 21 \times 5 \: meters[/tex]

[tex] \sf5\: seconds= 105 \: meters[/tex]

Therefore , the ostrich will run 105 meters in 5 seconds.

ANSWER PLZZ NO LINKS PORFA

How many miles longer is Trail A than Trail B?

Answers

It is longer by 67 miles you just minus them

What is -7w-4-5w+13 simplified?

Answers

-12W+9
It’s right I am an algebra 1 teacher

I WILL GIVE 30 POINTS TO THOSE WHO FILL IN THE BLANK CORRECTLY. A wire is needed to support a vertical pole 8 feet tall. The cable will be anchored to a stake 6 feet from the base of the pole. How much cable is needed?

Answers

Answer: The answer is 10 feet of cable.

A boat can travel 120 kilometers on 60 liters of gas. How far can it travel on 197 liters

Answers

Answer:

394 km

Step-by-step explanation:

197 is 197/60 times as much as 60

so the distance is also that much more: 120 km * 197/60 = 394

(1, 5), (2, 7), (3, 10), (4, 12) solve for domain

D={5, 7, 10, 12}


D={1, 2, 3, 4}


D={1, 5, 2, 7}


Cannot be determined

Answers

I think is is D={1, 2, 3, 4}

Classify the number -5
Integer

1. Whole Number

2. Irrational Number

3. Natural Number

Answers

Answer:

1. Whole number

Step-by-step explanation:

It's a negative number, but it is not a decimal, therefore it is a whole number.

Help me with this pleassssseeeedeeeeeeee..

Answers

We’re told that QR and RS are equal, so this is an isosceles triangle.

Meaning the two base angles must also be equal

Using this information, we know that the third angle must be 180 - (22 + 22), since the angles in a triangle add up to 180

helppppppppppppppppppppppppppppppppppppppp

Answers

4 in each and 2 left

1) Find the probability of rolling a
number greater than 3 on a standard
number cube.

Answers

Answer:

50%

Step-by-step explanation:

solve for x and explain the steps:
3x-6=4(2-3x)-8x

Answers

Answer: x = 14/23

Step-by-step explanation:

3x-6=4(2-3x)-8x

3x-6=8-12x-8x --> Expand 4(2-3x)

3x-6=8-20x --> Collect like terms

3x-6+6=8-20x+6 --> Add 6 to both sides, to remove it from the right side

3x=-20x+14

3x+20x=-20x+14+20x --> Add 20x to both sides, to remove it from the left side

23x=14

[tex]\frac{23x}{23}=\frac{14}{23}[/tex] --> Divide both sides by 23

x = 14/23

What is the cash payment of a article costing RS.2020 allowing a discount of Rs.20 and levying 13% VAT?​

Answers

The cash payment for the article is RS. 2,260.

A discount reduces the price of an item. The article becomes cheaper after the discount.

Cost of the article after the RS. 20 discount = RS. 2020 - 20 = RS 2000

VAT means value added tax. VAT increases the price of an item. The cost of the article increases by 13% after the  VAT is levied,

Cost of the article = (100 + 13%) x 2000

1.13 x 2000 = RS 2,260.

To learn more about taxes, please check: https://brainly.com/question/25311567

= 3 and 1/2 × 3 and 1/2

Answers

Step-by-step explanation:

please mark me as brainlest

what is 2/3 x 9/8 as a fraction in simplest form

Answers

Answer: [tex]\frac{3}{4}[/tex]

Have attached the picture for explanation...

The product of the fraction in the simplest form is 3/4

What is a fraction?

A fraction is a figure that is not a whole number. A fraction usually has a numerator and a denominator. The numerator is the number above. While the denominator is the number below.

What is the product of the fraction?

2/3 x 9/8 = 18/24 = 3/4

To learn more about multiplication of fractions, please check: https://brainly.com/question/1114498

Pls help! Will mark Branliest!! 50 points for whoever answers!!!!!!

Answers

Answer: See below

Step-by-step explanation:

Isolate x for x-2y+2z=9

3x=9+2y

[tex]x=\frac{9+2y}{3}[/tex]....(1)

Substitute (1) into the 2nd equation

[tex]\begin{bmatrix}-\frac{9+2y}{3}+3y=-4\\ 2\cdot \frac{9+2y}{3}-5y+3z=16\end{bmatrix}[/tex]

[tex]\frac{3\left(-9+7y\right)}{3}=3\left(-4\right)[/tex]

7y=-3

y=-3/7

Substitute y=-3/7

[tex]\begin{bmatrix}3z+\frac{18-11\left(-\frac{3}{7}\right)}{3}=16\end{bmatrix}[/tex]

[tex]\begin{bmatrix}3z+\frac{53}{7}=16\end{bmatrix}[/tex]

Isolate z by substituting it

[tex]3z+\frac{53}{7}=16[/tex]

[tex]\frac{3z}{3}=\frac{\frac{59}{7}}{3}[/tex]

[tex]z=\frac{59}{21}[/tex]

For x =9+2y/3 substitute z=59/21 and y=-3/7

[tex]x=\frac{9+2\left(-\frac{3}{7}\right)}{3}[/tex]

[tex]x=\frac{19}{7}[/tex]

[tex]x=\frac{19}{7},\:z=\frac{59}{21},\:y=-\frac{3}{7}[/tex]

Answer:

(1, - 1, 3 )

Step-by-step explanation:

x - 2y + 2z = 9 → (1)

- x + 3y = - 4 → (2)

2x - 5y + 3z = 16 → (3)

Add (1) and (2) term by term to eliminate x

y + 2z = 5 → (4)

Multiply (2) by 2

- 2x + 6y = - 8 → (5)

Add (3) and (5) term by term to eliminate x

y + 3z = 8 → (6)

Subtract (6) from (4) term by term to eliminate y

- z = - 3 ( multiply both sides by - 1 )

z = 3

Substitute z = 3 into (4)

y + 2(3) = 5

y + 6 = 5 ( subtract 6 from both sides )

y = - 1

Substitute y = - 1, z = 3 into (1) and solve for x

x - 2(- 1) + 2(3) = 9

x + 2 + 6 = 9

x + 8 = 9 ( subtract 8 from both sides )

x = 1

solution is (1, - 1, 3 )

Help plz im on a timer at school

Answers

Answer:

it is reduction so the answer is B.

Step-by-step explanation:

Can someone help me with these 2 problems I’ve been stuck on them for a very long time :’) tysm!!

Answers

Answer:

Christmas How many pouds this proportion to solve

5(x-2)-3= 5x-13
help me plz​

Answers

X has infinity solutions.

Autumn wants to invest $1000. The table below shows the value of her investment under two different options for three different years:

Number of years 1 2 3
Option 1 (amount in dollars) 1100 1200 1300
Option 2 (amount in dollars) 1100 1210 1331
Part A: What type of function, linear or exponential, can be used to describe the value of the investment after a fixed number of years using option 1 and option 2? Explain your reasoning. (4 points)

Part B: Autumn wants to invest in an option that would help to increase her investment value by the greatest amount in 7 years. Will there be any significant difference in the value of Autumn's investment after 7 years if she uses option 2 over option 1? Explain your answer, and show the investment value after 7 years for each option if the equation for option 1 is f(x)=100x + 1000 and the equation for option 2 is g(d) = 1000(1.1)d

Answers

Answer:

See below

Step-by-step explanation:

Part A

According the table, the yearly amount increases by 100 dollars in option 1 and 1.1 times in option 2.

It means the function is linear in option 1 and exponential in option 2.

Part B

Calculate the amount of total value in each case substituting x or d by 7 and compare the amounts:

f(7) = 100*7 + 1000 = $1700g(7) = 1000*(1.1)^7 = $1948.72 (rounded)

As we see the option 2 is better choice and the difference is:

$1948.72 - $1700 = $248.72

Lester has 2 toy cars. Ivan has t times as many toy cars as Lester. Write an expression that shows how many toy cars Ivan has

Answers

Answer:

I=2t

Step-by-step explanation:

ivan has 2 times t

You are virtually racing against your friend who lives on Spain where they use the metric system. You measured that you ran 430 feet per minute and your friend measured that they ran 6.5 kilometers per hour. Which of you is faster?

Answers

Pretty sure the friend ran faster (wait for more answers I’m not sure)
Other Questions
Who is Francois Mauriac and why, according to the Preface/Foreword, does he help Wieselget published? How does Mauriac describe Wiesel? Use textual evidence to support youranswer:I a group of 3 people are sharing chocolates each person wants 8 chocolates and each box has 4 chocolates 5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark pls help it is math for 7th grade. 108 is what percent of 72 The boys and the Darling children.... A rectangle with a width of 4.6 inches has an area of 23 inches squared. What is the length? The Later Middle Ages7Which of the following was the site of the only victory achieved by the Crusaders in the Second Crusade?OA. ConstantinopleOB. LisbonOC. EphesusODDamascus