1. What was the camp to the furthest point north?

Answers

Answer 1
Kaiserwald in Latvia
Answer 2

Neuengamme concentration camp was the camp to the furthest point north.

What is Neuengamme concentration camp?

Neuengamme was a Nazi concentration camp network in Northern Germany that included the main camp, Neuengamme, as well as more than 85 satellite camps.

It was situated on the grounds of an abandoned construction site on the commercial bank of the Dove-Elbe, a tributary of the Danube River, in the northern German Netherlands suburb Neuengamme.

The Neuengamme camp, created in 1938 near the village of Neuengamme in Hamburg's Bergedorf district, grew to become the largest concentration camp in Northwest Germany.

Therefore, The concentration camp in Neuengamme was the farthest north.

Learn more about the Neuengamme concentration camp, refer to:

https://brainly.com/question/15943629

#SPJ6


Related Questions

, Answer for brainilest and 10 points

Answers

Answer:

its the 2nd one

Explanation:

¿Qué es el parlamentarismo? ¿para qué fue creado' características principales ALGUIEN ME AYUDA CON ESO?????

Answers

Answer:

1.Se refiere a la forma de gobierno que constituye una aplicación deforme y excesiva del régimen parlamentario. ... El Parlamentarismo aparece en el siglo XIX en Europa, en países como Inglaterra, Italia, Holanda, Bélgica y Francia.

3.

Entre las características que son propias a los sistemas parlamentarios destacan: 1) el Parlamento elije al Jefe de Gobierno; 2) el Parlamento no comparte con ningún otro órgano del Estado la dirección de los asuntos públicos (el gobierno); 3) el Poder Legislativo se divide en dos cámaras; 4) el Jefe de Estado tiene una función simbólica, ya que no dispone de atribuciones políticas; 5) las prerrogativas del Ejecutivo se ejercen por medio del gabinete alrededor del primer ministro; 6) el gobierno surge y se mantiene gracias al respaldo de la mayoría parlamentaria; 7) el primer ministro y su gabinete están sujetos al control político, a través de diversos mecanismos, por parte del Parlamento, 8) la integración del Parlamento traduce la estructura del sistema de partidos; y, 9) el Parlamento puede destituir gobiernos y el Ejecutivo disolver al Parlamento.

La segunda no me la se

Primary Source Analysis—Sam Houston's Report of the Battle of San Jacinto How many Mexicans died in the battle?

Answers

The correct answer to this open question is the following.

Although there are no options attached we can say the following.

On April 25, 1836, General Sam Houston, commander-in-chief of the Texan Army, wrote his official report about the Battle of San Jacinto, close to Houston, Texas.

The report was addressed to D.G. Burnett, President of the Republic of Texas.

According to the report, 630 Mexican soldiers died in the battle, 208 were wounded and 730 captured.

This official Houston report can be found in the Archives of the State Library in Austin, Texas.

On April 21, 1836, the Texan troops led by General Sam Houston defeated the Mexican troops led by General Antonio López de Santana.


tax is collected to help fund local schools.

a. Property

b. Income

C. Franchise

d. Sales

Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

I think it's A or B because C & D doesn't make sense with the question .

Answer:

A: Property Tax

Explanation:

The attack on Pearl Harbor had which of the following consequences?
France stopped supporting the Allied troops.
The United States turned its back on German aggression and began to pursue Japan.
The United States resolved to enter World War II with full energy
The Axis Powers' victory was ensured.

Answers

Answer:

I believe the answer that makes the most sense is C

Explanation:

The attack on Pearl Harbor was a surpirse attack that Admiral Yammamoto planned. The US declared war on Japan the following day. When the US declared war on Japan, the Germans declared war on the US, leaving the US in conflict from all sides.

Answer:

C

Explanation:

During the Japanese bombing of Pearl Harbor, the United States entered the war, namely by first focusing on the Pacific theater and getting back at Japan, then the Atlantic theater to assist the Allied Powers.

Study this population map of Columbus, Ohio.

A population map of Columbus, Ohio. A key notes total population. The purple shaded areas are the highest amount of population from 2,201 to 38,000 people. The light shaded areas are the least amount of population from 0 to 800 people.

How could a city planner employed by the local government best use the data in this map to improve public services provided by the city?

to identify where to build new restaurants
to determine how to develop the empty area at the airport
to identify where more schools might need to be built in the future
to determine where more police will be needed to combat criminal activity

Answers

Answer:

it can look at the population and determine what they should bulid more or less

Explanation:

Answer:

to identify where more schools might need to be built in the future

Explanation:

which of these is an example of assimilation?
a. learning how to speak English
b. following ways from the old country
c. running a business in the immigrant's native language
d. celebrating a holiday from a native country

Answers

Answer:

a. learning how to speak English

Weapons and armor are a country's tools of violence. A warlike country, however huge and safe it may be, will end up declining and endangering its populace. Military force cannot be entirely eliminated nor used all the time. Teach people military arts when they are free from farming in order to equip them with a sense of military decorum and morale. . . . Confucius said, "Not teaching people how to fight is the same as discarding them." Hence military might serves to benefit the realm. This is the gist of the art of war.

Background Information: Taizong was the second emperor of the Tang dynasty.

When does Taizong want his officials to train the people for war?

in the springtime
when they are not busy farming
during peacetime
after war has begun

Answers

Answer:

Option B, when they are not busy farming

Explanation:

In the given piece of article, Taizong want  to teach people for war only when they are non practicing farming as depicted in the statement below

"Teach people military arts when they are free from farming in order to equip them with a sense of military decorum and morale"

Option A, C and D are incorrect because there is no mention of training people for war during spring time, peacetime and when there is no war.

Answer:

its b

Explanation:

How did the state of California become a free state?
The Compromise of 1850 was passed.
The Missouri Compromise was passed,
The Kansas Nebraska Act was passed,

Answers

Answer:

The Compromise of 1850 was passed

Explanation:

I got it right on test

Answer:

The Compromise of 1850 was passed

Explanation:

When saying the pledge of allegiance in class, the volume of each individual tends to go
down the larger the number of students in the class is. What phenomenon is causing this?
Social oafing
Social facilitation
Conformity
Reciprocity

Answers

Answer:

CONFORMITY

Explanation:

Read the passage from Sugar Changed the World. When the prophet Muhammad began preaching in A.D. 610, he attracted only a few disciples. Yet by the time he died in 632, his faith had spread throughout Arabia. By 642, the armies of Muslim conquerors, along with the arguments of the Muslim faithful, took the religion all across Syria, Iraq, parts of Iran, and Egypt. From there, Islam spread through North Africa along the Mediterranean, across to the Iberian Peninsula, and over to France. Islam's march into Europe ended in 732, when the French defeated the Muslim armies at the battle of Poitiers. But that was not all. Muslim rulers took Alexander's old lands in Afghanistan and then, from there, swept through to conquer northern India. The pagan tribes of Central Asia chose Islam. By conversion or conquest, Islam, the religion of Muhammad, won over nearly all the lands of the ancient world: Egypt, Persia, India, and the Christian Mediterranean. Which text features would be most helpful to support the central idea of the passage

Answers

Answer:

- a map showing the spread of Islam through much of the ancient world.

- a timeline showing the spread of Muhammad's teachings.

Explanation:

Text features are described as the different structures like tables, headings, Italics, diagrams, labels, captions, etc. that the authors employ to present the information in a more clear, efficient, effective, and easy to understand manner.

As per the question, the use of 'a map to display the spread of Islam in the ancient world along with a timeline displaying the dissemination of teachings of the prophet Muhammad' would make the information more impactful and assist the readers in understanding the idea author's purpose more quickly. The visual text features like map and timeline help the readers in comprehending the information better and easier.

Answer:

B and E are correct ;)

Explanation:

just took the test! ;)

What was Hernando de Soto's effect on the populations of the Mississippi
rive valley?

Answers

Answer:

De Soto's journey had a significant impact on the Native Americans of North America. He and his men were the first contact the majority of these tribes living in the interior had with Europeans, and they brought more than violence with them.

Explanation:

What caused Moses Austin to go bankrupt after the War of 1812?

Answers

Answer:

Austin quickly built a lead mine, smelter, and town on his property, and his mine turned a steady profit for more than a decade. Unfortunately, the economic collapse following the War of 1812 destroyed the lead market and left him bankrupt.

Explanation:

1. In what ways did the guards dehumanize people arriving at Auschwitz?

Answers

Answer:

The soldiers throw the Jewish people arriving at Auschwitz into the hand of NAZI Germany where they are ripped of all their belongings making them feel worthless.

Explanation:

Dehumanization was done through be titling of Jews into a situation where they had no belonging and they start feeling  themselves to be  useless or good for nothing. The soldiers put the Jewish into the hands of Nazi Germany. The Nazis kept the Jewish people in the concentration camp where they were forced to go through dehumanization process. They were stripped of everything they had

Which church leaders were immediately below cardinals in the Catholic Church hierarchy?

priests
bishops
emperors
archbishops

Answers

Answer:

Archbishops were the church leaders

Explanation:

Archbishops were the church leaders immediately below cardinals in the Catholic Church hierarchy.

Answer:

archbishops

Explanation:

Tension grew in 1775 as British troops controlled Boston. In response, the colonists

Answers

Answer:

Tension grew in 1775 as British troops controlled Boston. In response, the colonists agreed with the Intolerable Acts, consented to British rule, negotiated with the king, and formed armed militias.

Answer:A( agreed with the Intolerable Acts.(

Explanation: just took the test!

why were there so many more slaves in the south than the north?

Answers

In the south Slavery spread rather than grew because it was an agricultural rather than industrial form of capitalism, so it needed new lands. And slavery spread because enslaved African Americans were forced to migrate.

Slavery did not become a force in the northern colonies mainly because of economic reasons. Cold weather and poor soil could not support such a farm economy as was found in the South. As a result, the North came to depend on manufacturing and trade. Trade was the way colonists got the English goods they needed.

Hope this helps

Issues of taxation helped spark each revolution. In each revolution, Enlightenment ideas contributed to the popular desire for more rights and liberties. b The American Revolution overthrew a distant colonial ruler. In the French Revolution, the people overthrew their own existing social order. c The American Revolution guaranteed freedom of religion; the French Revolution challenged the role of the Catholic Church. d Both revolutions led to violence. However, the American Revolution proved much more violent than the French Revolution.

Answers

Answer:

All of the above

Explanation:

Considering the available options, hence the right answer to the issues of taxation that helped spark each revolution is ALL OF THE ABOVE.

The revolution that is being referred to here is both the American revolution against the British and the French Revolution against the French monarchy. All of which occurred in the 18th century

9. What is the difference between an authoritarian dictatorship like Fidel Castro in
Cuba, and a totalitarian dictatorship as practiced by Adolf Hitler?

Answers

Answer: See explanation

Explanation:

Authoritarianism is the form of political system whereby the leader has so much power and isn't constitutionally responsible to the people. Authoritarian leaders doesn't regard the laws that exist in the state and it's hard for to them to be replaced by another candidate in an election.

On the other hand, totalitarianism prohibits opposition parties and also have control over the life of the people as the people have no individual freedom and they're under the authority of the state.

What did the Japanese hope to accomplish with the attack on Pearl Harbor?
destruction of the U.S. Pacific Fleet
destruction of the Allied Powers
the fall of the United States
none of the above

Answers

Answer:

none

Explanation:

Explain what an abolitionist is or what the abolitionist movement was about in your own words

Answers

Abolitionism, or the abolitionist movement, was the movement to end slavery. In Western Europe and the Americas, abolitionism was a historic movement that sought to end the Atlantic slave trade and liberate the enslaved people.

[tex]STAYBLESSED[/tex]

Answer:

Abolitionist - A person who pretty much wants to get rid of a practice or a tradition ( slavery)

Abolitionism, or the abolitionist movement, was the movement to end slavery like the civil war

Explanation:

Fredrick Douglass was A abolitionist. He was against Slavery and displayed that very publically. Abraham Lincoln Abolished slavery ( Ended it ) However his motives for doing so weren't too straight on the Moral compass.

Does honor exist in today’s society? How would you define honor

Answers

Honor is defined as a intangible asset that determines how other treat you

It still exists till today and it’s a very easy thing to lose, like all things, it’s hard to get back

I’d define it as a useless thing that should be discarded before people kill each other (more than they already do)

Answer:

Honor is an abstract concept that includes personal, individual values (“ethos”) as well as norms of social interaction. Honor is a measure of the quality of a person, including personal ethics, e.g.. Honor lies at the core of who we are and aspire to be, how we make choices. When making difficult choices, when the consequences are significant.  Suppose that each of us could have a personal honor Blockchain that basically records all of our values and social interactions as demonstrated throughout our lives.

Honor definition: noun, high respect; great esteem / adherence to what is right or to a conventional standard of conduct.

"Does honor exist in today’s society?" your answer is yes depending on the way you see it.

hope this helps :P

Why did it require tremendous courage for Dr. King to speak in Montgomery, when the march was completed?

Answers

Answer: After Jackson died of his wounds just over a week later in Selma, leaders called for a march to the state capital, Montgomery, to bring attention to the injustice of Jackson's death, the ongoing police violence, and the sweeping violations of African Americans' civil rights.

It required tremendous courage for Dr. King to speak in Montgomery, Alabama, after the completion of the march from Selma because of the tense and volatile atmosphere at the time.

What was the response to the Selma march?

In support of the voting rights marchers, sympathizers organized sit-ins, traffic jams, and protests. Some even made the trip to Selma, where King attempted a second march two days later but was forced to turn around when troopers once again blocked the road at the Edmund Pettus Bridge, much to the dismay of some protesters.

In March 1965, Dr. King led a march from Selma to Montgomery to demand voting rights for African Americans. The march was met with violent opposition from local authorities and white supremacist groups.

The protesters were beaten, tear-gassed, and some were even killed, including a young man named Jimmie Lee Jackson. However, the march was successful in raising awareness about the need for voting rights and eventually led to the passage of the Voting Rights Act of 1965.

After the completion of the march, Dr. King's life was still in danger as he continued to face threats and violence from those who opposed his message. Despite this, he decided to speak at a rally in Montgomery to celebrate the success of the march and to call for further action toward equality and justice.

Learn more about the Selma march here:

https://brainly.com/question/30158378

#SPJ3

What is the historical context of the renaissance in Western Europe? (What led/caused the renaissance)

Answers

Historians have identified several causes for the emergence of the Renaissance following the Middle Ages, such as: increased interaction between different cultures, the rediscovery of ancient Greek and Roman texts, the emergence of humanism, different artistic and technological innovations,

How many climate zones are in Central America?
O
05
07
3

Answers

There are 3 or 5 climate zones in Central America.

What was the name of Mao's Communist movement of China?

Answers

Answer:

Chinese Communist Party(CCP)

Explanation:

Predict how the outcome of World War I might have been different if the United States had not entered the war.
700

Answers

Answer:

Many things could have happened, The Nazi's could have taken over Brittan and combined the armies and taken over countries such as Poland or the Americas

Explanation:

How can personal property impact the process of applying for a loan with a bank? A. A bank will want to see that the loan money is not going to be used for something already belonging to the applicant. B. A bank is more likely to approve a loan to someone if valuable assets and collateral can be shown. O C. Personal property is not important because a bank is not concerned with personal property, only income. O D. A bank is more likely to approve a loan to someone who has no property and really needs help.​

Answers

Answer:

B. A bank is more likely to approve a loan to someone if valuable assets and collateral can be shown.is your answer

This body of water is located to the west of Ryukyu Island chain and east of China

Answers

Answer:

The East China Sea and the South China Sea together form the China Sea. The East China Sea extends to the east to the chain of the Ryukyu Islands; north to Kyushu, which is the southernmost of Japan's main islands; northwest to Cheju Island off South Korea; and hence west to China.

Explanation:

Georgian entrepreneur ________ helped Georgia’s economy grow by turning an invention for a new type of hosiery it into a multibillion dollar industry.

A. Ted Turner
B. Sara Blakely
C. C.E Woolman
D. Alonzo Herndon

Answers

Answer:

Sara Blakey

Explanation:

Verified by several online sources, including Quizlet.

Let me know if I am correct! :>

Sara Blakely helped Georgia economy
Other Questions
AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash. Felix has a bucket of golf balls. The table shows the number of golf balls of each color in the bucket.Felix selects a golf ball at random. Based on the information on the table, which statement is true? A 3ft child casts a 2ft shadow at the same time a tree casts a shadow that is 6ft long how tall is the tree? Argentina is considering constructing a bridge across the Rio de la Plata to connect its northern coast to the southern coast of Uruguay. If this bridge is constructed, it will reduce the travel time from Buenos Aires, Argentina, to Sao Paulo, Brazil, by over 10 hours and has the potential to significantly improve the flow of manufactured goods between the two countries. The cost of the new bridge, which will be the longest bridge in the world, spanning over 50 miles, will be $700 million. The bridge will require an annual maintenance of $10 million for repairs and upgrades and is estimated to last 80 years. It is estimated that 550,000 vehicles will use the bridge during the first year of operation, and an additional 50,000 vehicles per year until the tenth year. These data are based on an a toll charge of $90 per vehicle. The annual traffic for the remainder of the life of the bridge life will be 1,000,000 vehicles per year. The Argentine government requires a minimum rate of return of 9% to proceed with the project.(a) Does this project provide sufficient revenues to offset its costs?(b) What considerations are there besides economic factors in deciding whether to construct the bridge Name the part in red:H2 + O2 -> H2O The angle of elevation to a building in the distance is 22. You know that the building is approximately 450ft tall. Estimate the distance to the base of the building The Brownie camera was a popular camera not just because of a great advertising campaign by Eastman but because the average person could use it. Write a brief essay describing at least three ways the Brownie was made easier to use for the average citizen. PLEASE HELP! In the figure below, mR is 66, and mT is 122.Note: Figure is not drawn to scale. What is mQ? A. 58 B. 56 C. 24 D. 124 how did the installment buying impact america life today? HELP PLEASE. urgent help needee Five angles of a hexagon measure 119, 129, 104, 139 and 95 degrees. What is the measure of the sixth angle? Which expression gives the volume of a sphere with radius 16?O A. $ r (262)B. 47(262)O C. (163)O D. 4t(153) When elemental sodium reacts with water, sodium hydroxide and hydrogen will form. What mass of sodium (in grams) must be reacted with excess water to produce 325 mL of hydrogen gas at 25.0oC and 1.15 atm? Which of the following best describes a direct benefit in using redundant routing on the Internet?a. Redundancy often allows messages to be sent on the network even if some network devices or connections have failed.b. Redundancy enables messages to be transmitted with as few packets as possible.c. Redundancy enables network devices to communicate with as few network connections as possible.d. Redundancy prevents network communications from being intercepted by unauthorized individuals. Approximately what percent of the landmass on earth receivesvery little or no rainfall? Select the correct answer.What is the purpose of the IRS?A. to collect taxes and enforce tax lawsB. to provide a collection of domestic and foreign securitiesC. to foster cooperation between nations to solve economic issuesD. to ensure fair global trade practices How does Lenina react to the environment and people at the Reservation? What does the fact that she condemns it as "queer" tell you about her conditioning? Limestone has a density of 2.72 g/cm3. What is the mass of 8.92 cm3 of limestone? help me please ;-; math hurts my head Question Below! 20 points!