1. If mPQ = 130°, find mRQ.

Answers

Answer 1

Answer:

mRQ = 50

Step-by-step explanation:

180-130=50


Related Questions

A cylindrical water tank is 12 feet high and 10 feet in diameter. the entire tank, inside and out, is to be painted. if a gallon of paint covers 200 sq ft, how many gallons will be needed?

Answers

if we paint the tank on the outside, we'll be covering SA of surface area, however we're also painting it on the inside, so the area inside assuming the material thickness is negligible, we'll be covering SA as well, so we'll be needing SA + SA = 2SA ft² of paint to do the whole thing.

so, its diameter is 10, that means its radius is 5.

[tex]\textit{surface area of a cylinder}\\\\ SA=2\pi r(h+r)~~ \begin{cases} r=radius\\ h=height\\[-0.5em] \hrulefill\\ h=12\\ r=5 \end{cases}\implies \begin{array}{llll} SA=2\pi (5)(12+5)\implies SA=170\pi \\\\\\ \stackrel{\textit{twice as much}}{2SA=340\pi } \end{array}[/tex]

now, hmmm we know that 1 gallon can do 200 ft², how many gallons are there in 340π ft²?

[tex]\begin{array}{ccll} gallons&ft^2\\ \cline{1-2} 1 & 200\\ x& 340\pi \end{array} \implies \cfrac{1}{x}~~=~~\cfrac{200}{340\pi } \\\\\\ 340\pi =200x\implies \cfrac{340\pi }{200}=x\implies \stackrel{gallons}{5.34}\approx x[/tex]

Cylinder A has a radius of 10 inches and a height of 5 inches. Cylinder B has a volume of 750n. What is the percentage change in volume between cylinders A and B? Cylinder B is 50% smaller than cylinder A. Cylinder B is 75% smaller than cylinder A Cylinder B is 50% bigger than cylinder A Cylinder B is 200% bigger than cylinder A

Answers

Answer: Cylinder B is 50% bigger than cylinder A

Cylinder A volume:

= πr²h

= π(10)²(5)

= 500π

Cylinder B volume:

= 750π

Cylinder B bigger than Cylinder A by:

= (750π - 500π)/500π × 100 = 50%

[tex]\hrulefill[/tex]

Hence, cylinder B is bigger than cylinder A by 50%

Answer:

Cylinder B is 50% bigger than Cylinder A

Step-by-step explanation:

[tex]\textsf{Volume of a cylinder}=\sf \pi r^2 h \quad\textsf{(where r is the radius and h is the height)}[/tex]

Cylinder A

Given:

r = 10 inh = 5 in

Substituting the given values into the formula:

[tex]\implies \sf Volume_A=\pi (10)^2(5)=500\pi \:in^3[/tex]

Cylinder B

Given:

volume = 750 in³

[tex]\implies \sf Volume_B=750\pi \:in^3[/tex]

Percentage Change

[tex]\begin{aligned}\sf percentage\:change & =\sf \dfrac{final\:value-initial\:value}{initial\:value} \times 100\\\\& = \sf \dfrac{Volume_B-Volume_A}{Volume_A} \times 100\\\\& = \sf \dfrac{750\pi-500\pi}{500\pi} \times 100\\\\& = \sf \dfrac{1}{2} \times 100\\\\& = \sf 50\%\end{aligned}[/tex]

Therefore, Cylinder B is 50% bigger than Cylinder A

Combine the radicals [tex]9\sqrt{x} -3\sqrt{x} \\[/tex]

Answers

The combination of the radicals 9√x - 3√x will be equal to 6√x.

What is a radical?

The radical is the symbol that is used to represent the root in the expression n√x.

The given radicals can be combined as shown below,

9√x - 3√x

Taking √x as the common term,

= √x(9-3)

= 6√x

Hence, the combination of the radicals 9√x - 3√x will be equal to 6√x.

Learn more about the Radical:

https://brainly.com/question/1369233

#SPJ1

1. How many ways can Grant arrange 3 of his 10 plants on a window ledge?


2. A parade organizer received 8 entries for floats. How many ways can he arrange 4 floats out of the 8 entries?


3. Express 4! in expanded form.


4. The number of ways 15 members of a 24-member club can be arranged. ( use permutation notation). PLEASE HELP ME!! and thankyou

Answers

The number of ways that Grant can arrange 3 of his 10 plants on a window ledge is 120 ways

How to solve the combination problem?

The number of ways that Grant can arrange 3 of his 10 plants on a window ledge will be:

= 10!/(10! - 3!)3!

= 10!/7!3!

= (10 × 9 × 8)/(3 × 2)

= 120

When the parade organizer received 8 entries for floats, the number of ways that he can arrange 4 floats out of the 8 entries will be:

= 8!/(8! - 4!)4!.

= 8!/4!4!

= (8 × 7 × 6 × 5)/(4 × 3 × 2)

= 70

4! in expanded form will be:

= 4 × 3 × 2

= 24

Learn more about combinations on:

brainly.com/question/11732255

#SPJ1

Find all the missing side lengths for the following ITS WORTH 20 points plsss help and ill like !!

Answers

the answer is in the photo

Does anyone know the answer to this ?

Answers

Answer:

5182

Step-by-step explanation:

To figure out the mean of a number, you must add all of the numbers together and divide by the amount of numbers you added up.

To find the total sum, we just need to reverse this process.

We are already given the final number so all we have to do is multiply the mean by 100 and we have our answer of 5182.

Hope this helps :D

Mike buys a large goldfish for $22 and food for his new friend
that costs $3. He receives a birthday with $5 in the afternoon.
Then Mike had $7. How much money did he start the day off
with

Answers

Answer:

Mike started off the day with $27.

Step-by-step explanation:

Using the information given to us, we can set up an equation. Knowing that Mike ended the day with $7, and the amount of money that he spent and received can help us set up an equation. The amount of money that he started the day off with, is unknown, and recognized as x.  [tex]7=x-22-3+5[/tex]

To solve this, we can simply solve the numbers that we know on the right hand side, to get this:

[tex]7=x-20[/tex]

Now, to get our final answer we must isolate x. We can do this by simply adding 20 to both sides. This cancels out the -20 on the right, and makes the 7 on the left become 27.

[tex]27=x[/tex]

Therefore, Mike started the day off with $27.

Which two details support the key idea that pollution is threatening marine life?

Marine Debris
Source: The National Oceanic and Atmospheric Association
Marine debris is a persistent pollution problem that reaches throughout the entire ocean and Great Lakes. Our ocean and waterways are polluted with a wide variety of marine debris, ranging from tiny microplastics, smaller than 5 mm, to derelict fishing gear and abandoned vessels. Worldwide, hundreds of marine species have been negatively impacted by marine debris, which can harm or kill an animal when it is ingested or they become entangled, and can threaten the habitats they depend on. Marine debris can also interfere with navigation safety and potentially pose a threat to human health.
All marine debris comes from people with a majority of it originating on land and entering the ocean and Great Lakes through littering, poor waste management practices, storm water discharge, and extreme natural events such as tsunamis and hurricanes. Some debris, such as derelict fishing gear, can also come from ocean-based sources. This lost or abandoned gear is a major problem because it can continue to capture and kill wildlife, damage sensitive habitats, and even compete with and damage active fishing gear.

Answers

Answer:

Worldwide, hundreds of marine species have been negatively impacted by marine debris, which can harm or kill an animal when ingested or they become entangled, and can threaten the habitats they depend on.

This lost or abandoned gear is a major problem because it can continue to capture and kill wildlife, damage sensitive habitats, and even compete with and damage active fishing gear.

Step-by-step explanation:

The key idea is that pollution is threatening marine life impact of marine life and the source of marine debris.

Marine debris is risky to a wide variety of marine animals. Animals can ingest debris, which can cause health problems or death, or they may get caught in debris, which can be equally harmful. In addition, marine debris harms the environments in which many species rely on being alive.

The greater part of marine garbage is caused by human activity on land. Marine debris is produced by poor waste management methods, dumping waste, stormwater discharge, and natural disasters such as tsunamis and hurricanes. Furthermore, ocean-based sources, such as wasted fishing gear, contribute to the problem.

The key idea is that pollution is threatening marine life impact of marine life and the source of marine debris.

Learn more about marine debris here:

https://brainly.com/question/33715844

#SPJ5

Which is a coefficient in the expression below?

(r – 2) + s(10 – t)

Answers

Answer:

-2

Step-by-step explanation:

coefficient is the number without a letter next to it

kelly recorded the amount of money she earned y for hours worked x in the table shown

Answers

Answer:

10

Step-by-step explanation:

4 overtime hours - regular pay + $40

Total $ earned - $160

Total hours - 12 hours (8 reg + 4 overtime)

$160 - $40 = $120

$120/12 = $10

Her regular pay is $10 per hour.

PLEASE HELP!!! LOOK AT PIC PLEASE!!

Answers

Answer: C, D

Step-by-step explanation:

Acute angles of right triangles are complementary, and the sine of an angle is equal to the cosine of its complement.

Find the value of x in the triangle shown below.
x=
58°
6
6
20%
5.8

Answers

Answer:

x = 61°

Step-by-step explanation:

since the triangle has 2 congruent sides then it is isosceles with the 2 base angle being congruent, both x°

the sum of the 3 angles in the triangle = 180° , then

x + x + 58° = 180°

2x + 58° = 180° ( subtract 58° from both sides )

2x = 122° ( divide both sides by 2 )

x = 61°

Find the value of k (k,3) and (2,3) is 5
A: 5
B: 6
C: 7
D: 8​

Answers

Answer:

its option c (7)

Step-by-step explanation:

trust your bro

Answer:

[tex]C)~ 7[/tex]

Step-by-step explanation:

[tex]\text{Given that,}~~ (x_1,y_1) = (k,3)~ \text{and}~ (x_2 ,y_2) = (2,3)\\\\\text{Distance,}~ \\\\~~~~~~~~d= \sqrt{(x_2 -x_1)^2 + (y_2 -y_1)^2}\\\\\implies 5=\sqrt{(2-k)^2 + (3-3)^2}\\\\\implies 5=\sqrt{(2-k)^2 +0}\\\\\implies 5 = \sqrt{(2-k)^2}\\\\\implies 5=|2-k|\\\\\implies \pm 5=2-k \\\\\implies 2-k =5~~~~~~\text{or}~~~~~~~~2-k = -5\\\\\implies k = 2-5~~~~~~\text{or}~~~~~~~~k = 2+5\\\\\implies k = -3~~~~~~~~~\text{or}~~~~~~~~k = 7[/tex]

Select the correct answer.
Consider the function given below.
f(x)= |x-51 +2
Which of the following statements about the y-values of the graph of the function is true?
OA. The y-values are all less than or equal to 5.
B.
The y-values are all greater than or equal to 5.
OC.
The y-values are all less than or equal to 2.
D.
The y-values are all greater than or equal to 2.

Answers

Answer: The correct answer is D.

Step-by-step explanation: A and B are incorrect because you can plug in 5 for x to get 2, and there are multiple values that can be greater than 5. C is incorrect because you cannot reach lower than 2. Therefore, the correct answer is D.

The y values are all greater than or equal to 2.

The correct option is D.

Given,

Function : f(x) = |x − 5| + 2

Here,

A function is a law that relates a dependent and independent variable.

The function is

f(x) = |x − 5| + 2

The domain of the function is all negative and positive integers.

The range is all the possible function values, the function value will always be greater than or equal to 2.

At x = 5 , f(x) = 2

Therefore, the y values are all greater than or equal to 2. The correct option is D.

To know more about Function,

brainly.com/question/12431044

#SPJ6

Pineapples were packed in three large crates. for each crate, the weight of every pineapple in the crate was recorded. here are three box plots that summarize the weights in each crate. select all of the statements that are true, according to the box plots. (select all that apply. ) the weights of the pineapples in crate 1 were the most variable. the heaviest pineapple was in crate 1. the lightest pineapple was in crate 1. crate 3 had the greatest median weight and the greatest iqr. more than half the pineapples in crate 1 and crate 3 were heavier than the heaviest pineapple in crate 2

Answers

The correct statements are:
the weights of the pineapples in crate 1 were the most variable.The heaviest pineapple was in crate 1.More than half the pineapples in crate 1 and crate 3 were heavier than the heaviest pineapple in crate 2.

What are the correct statements?

A box plot is used to study the distribution and level of a set of scores. The box plot consists of whiskers which measure the minimum and maximum numbers. The difference between these numbers is the range which measures variability.

On the box, the first line to the left represents the lower (first) quartile. The next line on the box represents the median. The third line on the box represents the upper (third) quartile.  The difference between the first quartile and the third quartile is the interquartile range.

For the first box plot:

Maximum number = 6Minimum number  = 1.5Range = 6 - 1.5 = 4.5Median  = 4First quartile = 3Third quartile = 4.5IQR = 4.5 - 3 = 1.5

For the second box plot:

Maximum number = 3.5Minimum number  = 1 Range = 3.5 - 1 = 2.5Median  = 2First quartile = 1Third quartile = 2.5IQR = 2.5 - 1 = 1.5

For the third box plot:

Maximum number = 5Minimum number  =2.5Range = 5 - 2.5 = 2.5Median  = 4First quartile = 3.5Third quartile = 4.5IQR = 4.5 -  3.5 = 1

Please find attached the box plots. To learn more about box plots, please check: https://brainly.com/question/27215146

#SPJ1

What is the product of (2x – 6)(2x + 6)

Answers

[tex]~~~(2x-6)(2x+6)\\\\=(2x)^2 -6^2~~~~~~~~~~~~~~~~~~~~~;[a^2 -b^2 = (a+b)(a-b)]\\\\=4x^2 -36[/tex]

Parallel to y=12x−4, through (4, 5)

Write the slope intercept form of each equation of the line. Use a fraction for slope

Answers

Answer: y = 12x - 43

Step-by-step explanation: i hope that helps

If f(x) = (1/9)(9*), what is f(3)? A. 729 B. 81 C.1/729 D.1/81​

Answers

Answer:

B. 81

Step-by-step explanation:

Note. It is assumed * is x in the function notation.

Given

Function f(x) = (1/9)(9ˣ)

Rewrite it as:

f(x) = 9⁻¹ 9ˣ = 9⁻¹⁺ˣ = 9ˣ⁻¹

Find f(3)

Substitute the value of x into equation:

f(3) = 9³⁻¹ = 9² = 81

Correct answer choice is B

Please please please help meeeeeeeee and I WILL mark you brainliest ​

Answers

microphone is one of the world's quietest microphones, and it comes complete with a ton of essential access

please hurry it’s timed
Which of the following is an asymptote of y=csc(x)?
x= -pi
x= -pi/3
x= pi/4
x= pi/2

Answers

Answer:

x = -π

Step-by-step explanation:

An asymptote line is a line that the graph does not intercept or pass through but rather approaches it. An asymptote line also is considered to be a line of undefined value of function because if an asymptote is x = a then f(a) is undefined.

The question gives a function y = csc(x) which is in another form, y = 1/sin(x).

We have to find the value of x that turns the function in undefined and that x-value will be your asymptote.

From a unit circle, we know that sin(-π) = -sin(π) = 0. Since sin(-π) = 0 —> y = csc(-π) = 1/sin(-π) = 1/0

Now we find out that at x = -π, csc(x) is not defined and hence, an asymptote is x = -π

Choose the correct option that explains what steps were followed to obtain the system of equations below.

System B



A.
To get system B, the second equation in system A was replaced by the sum of that equation and the first equation multiplied by 3. The solution to system B will be the same as the solution to system A.
B.
To get system B, the second equation in system A was replaced by the sum of that equation and the first equation multiplied by -6. The solution to system B will not be the same as the solution to system A.
C.
To get system B, the second equation in system A was replaced by the sum of that equation and the first equation multiplied by -5. The solution to system B will not be the same as the solution to system A.
D.
To get system B, the second equation in system A was replaced by the sum of that equation and the first equation multiplied by 5. The solution to system B will be the same as the solution to system A.

Answers

To get system B, the second equation in system A was replaced by the sum of that equation and the first equation multiplied by 5. The solution to system B will be the same as the solution to system A.

How to find the relationship between two equations?

System A equations:

-x - 2y = 7  ------ (1)

5x - 6y = -3  ------(2)

We multiply the first equation by 5, to get :

-5x - 10y = 35 -----(3)

The sum of equation (2) and equation (3) gives:

-16y = 32

y = 32/-16

y = -2

Thus, solution of system B is;

-x - 2(-2) = 7

-x + 4 = 7

x = -3

So, the solution of system B is (-3, -2), that means the solution of both systems are same.

Read more about equations at; https://brainly.com/question/2972832

#SPJ1

BRAINLIEST!!!!

Use triangle XYZ to answer the questions


Use special right triangles to help find the length of segment XY. What is the exact base of triangle XYZ?


What is the exact area of triangle XYZ? Leave your answer in RADICAL terms



What is the area of triangle XYZ to the nearest tenth of a Square feet

Answers

The trigonometric function gives the ratio of different sides of a right-angle triangle. The area of the triangle is 55.4256 ft².

What are Trigonometric functions?

The trigonometric function gives the ratio of different sides of a right-angle triangle.

[tex]\rm Sin \theta=\dfrac{Perpendicular}{Hypotenuse}\\\\\\Cos \theta=\dfrac{Base}{Hypotenuse}\\\\\\Tan \theta=\dfrac{Perpendicular}{Base}[/tex]

where perpendicular is the side of the triangle which is opposite to the angle, and the hypotenuse is the longest side of the triangle which is opposite to the 90° angle.

For the given triangle the length of AB and BC can be written as,

[tex]\rm Sin \theta=\dfrac{Perpendicular}{Hypotenuse}\\\\\\Sin(30^o) = \dfrac{AB}{AC}\\\\\\AB = Sin(30^o) \times 16 \\\\\\AB=8\rm\ ft[/tex]

[tex]Cos \theta=\dfrac{Base}{Hypotenuse}\\\\\\Cos(30^o) = \dfrac{BC}{AC}\\\\\\BC = Cos(30^o) \times AC\\\\\\BC = 13.8564\rm\ ft[/tex]

Now, the area of the triangle is,

Area of triangle = 0.5× 8 × 13.8564 = 55.4256 ft²

Hence, the area of the triangle is 55.4256 ft².

Learn more about Trigonometric functions:

https://brainly.com/question/6904750

#SPJ1

A triangle has a base of 53 and a height of 21. What is the hypotenuse?

Answers

Answer:

Approximately 57

Step-by-step explanation:

The Pythagorean theorem says that a^2+b^2=c^2, where a and b are the base and height, while c is the hypotenuse. 53^2+21^2=2809+441=3250. The square root of 3250 is 57.008771255, which rounded to the nearest tenth is 57. Hope this helped!

Answer:

57.008771255 or 57

Step-by-step explanation:

53^2+21^2=57.008771255^2

complete the equation of the line.​

Answers

Answer:

see the attachment photo!

to get the equation of any straight line, we simply need two points off of it, let's use the provided points in the picture above.

[tex](\stackrel{x_1}{0}~,~\stackrel{y_1}{-3})\qquad (\stackrel{x_2}{1}~,~\stackrel{y_2}{1}) ~\hfill \stackrel{slope}{m}\implies \cfrac{\stackrel{rise} {\stackrel{y_2}{1}-\stackrel{y1}{(-3)}}}{\underset{run} {\underset{x_2}{1}-\underset{x_1}{0}}} \implies \cfrac{1 +3}{1 +0}\implies 4 \\\\\\ \begin{array}{|c|ll} \cline{1-1} \textit{point-slope form}\\ \cline{1-1} \\ y-y_1=m(x-x_1) \\\\ \cline{1-1} \end{array}\implies y-\stackrel{y_1}{(-3)}=\stackrel{m}{4}(x-\stackrel{x_1}{0}) \\\\\\ y+3=4x\implies y=4x-3[/tex]

Any Help Will Be Appreciated!

Answers

Answer:

-148

Step-by-step explanation:

Hello!

We can evaluate by plugging in -3 for x, and -7 for y in the expression [tex]3x^3 - 2x^2 + 7y[/tex]

Evaluate[tex]3x^3 - 2x^2 + 7y \text{ for x=-3, and y=-7}[/tex][tex]3(-3)^3 - 2(-3)^2 + 7(-7)[/tex][tex]3(-27) - 2(9) - 49[/tex][tex]-81 - 18 - 49[/tex][tex]-148[/tex]

The evaluated value is -148.

Answer:

-148

Step-by-step explanation:

Which expression is equivalent to -6.50 -5.1 + 2.3c - 1.8?

Answers

Answer:

-13.4+2.3c

Step-by-step explanation:

Add the like terms.

-6.5-5.1-1.8=-13.4

-13.4+2.3c

Hope this helps!

If not, I am sorry.

-4.625,-5.2,-4 4/5, -4 8/11 order least to greatest

Answers

Answer:

-4.625, -4 8/11, -4 4/5, -5.2

Step-by-step explanation:

-4 8/11 = -4.72727272723

-4 4/5 = -4.8

In one day, Joe consumes 530 calories by drinking 1 serving of juice, 2 servings of milk, and 1 soda. Darius consumes 370 calories by drinking 2 servings of juice and 1 serving of milk. Marian consumes 510 calories by drinking 3 servings of milk and 1 soda. Using matrices to solve, how many calories are in 1 serving of milk?


Answers

Therefore, 110 calories are in 1 serving of milk.

Given, Joe consumes 530 calories by drinking 1 serving of juice, 2 servings of milk, and 1 soda.

Darius consumes 370 calories by drinking 2 servings of juice and 1 serving of milk.

Marian consumes 510 calories by drinking 3 servings of milk and 1 soda.

What are Linear Programming problems?

Linear programming, commonly known as LP, is a straightforward technique for representing complex real-world interactions by means of a linear function.

Now,

Let the calories in one serving of milk be x

Let the calories in one serving of juice be y

Let the calories in one serving of soda be z

For Joe, the equation to show the amount of calories is

2x + y + z = 530 -----(1)

For Darius, the equation to show the amount of calories is

x + 2y = 370 ------(2)

For Marian, the equation to show the amount of calories is

3x + z = 510 ------(3)

Now, y=370/2-x/2 and z=510-3x substitute in the equation 2x + y + z = 530.

2x+185-0.5x+510-3x=530

⇒695-1.5x=530

⇒1.5x=165

x=110 calories

Hence, 110 calories are in 1 serving of milk.

To learn more about linear programming visit:

https://brainly.com/question/15417573.

#SPJ1

Jennifer starts a new investment account that grows exponentially. Her financial advisor tells her
the initial investment of $50,000 grows at a rate of about 15% annually.
1. Determine a function, I(t), that determines Jennifer’s investment account balance after t years. For the exponential growth function, what are the “a” and “b” values? What do those values represent? (5 points for the explanation of “a” and “b” and 5 points for the function)

Answers

The exponential function is given by [tex]I(t) = 50000(1.15)^t[/tex]. The initial investment of $50,000 grows at a rate of about 15% annually.

What is an equation?

An equation is an expression that shows the relationship between two or more numbers and variables.

An exponential function is in the form:

y = abˣ

Where a is the initial value and b is the rate of increase per period.

Let I(t) represent Jennifer’s investment account balance after t years, hence:

a = 50000, b = 100% + 15% = 115% = 1.15

[tex]I(t) = 50000(1.15)^t[/tex]

The exponential function is given by [tex]I(t) = 50000(1.15)^t[/tex]. The initial investment of $50,000 grows at a rate of about 15% annually.

Find out more on equation at: https://brainly.com/question/2972832

#SPJ1

Order these numbers from least to greatest. 6.2052, 6.2, 6.75, 6.705

Answers

Answer:

6.2 , 6.2052 , 6.705 , 6.75

Step-by-step explanation:

Least to Greatest!

Other Questions
Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain. A chemical reaction can be reversed if?The energy of the reactants exceeds the activation energy threshold.The energy of the products exceeds the activation energy threshold.The energy of the reactants is less than the activation energy threshold.The energy of the products is less than the activation energy threshold. Miguel Rodriguez borrowed $300 from his brother Julio to pay for books and tuition. He agreed to pay Julio in 6 months with simple annual interest at 6.9% Someone please help fast!Simplify: in the picture Choose the correct verb in subjunctive and complete the following sentences.Espero que sean/conozcan las pirmides de Egipto What is f(x) + f(x) + f(x)? 3f(x)3f(x) = 3xEvaluate 3f(2) = . Which topic below would be a good one for a demonstration?steps for safety during an earthquakewhy frogs sing after it rainswhat to look for in a petwhere Canada is on a map (3x-2)(3x-2)(3x-2)(2x+1)